Loading...
HomeMy WebLinkAbout1977-04-06 Council PacketCOUNCIL PACKETS APRIL i I .. m Kenai City Council Meeting Packet April 6, 1977 r` q VI 1 "1 ' COUNCIL MEETING OF �nnr. a �o�o AMBARIAN +•� ALN ` V q L/ H '- q }� MORGAN ^ C I I L / q Iq N it GLICK SWEET X y `�y �, (� I ACKERLY -��- V ELSON l " l �, q 1 �� 4 F {� COUNCIL MEETING Or AMBARIAN WHELAN y �9 tl -1 ' 1 q`'l U N IL4H N MORGAN GLICK -I L' / "1 V I I -I I�► "' • SWEET ACKERLY ELSON • �J 1 11 klY • � N N 3 3, 1 S s. i, S4i i i AGENDA REGULAR MEETING - KENAI CITY COUNCIL APRIL 6. 1977 - 8:00 P.M. KENAI PUBLIC SAFETY BUILDING PLEDGE OF ALLEGIANCE. A. ROLL CALL AGENDA APPROVAL B. PUBLIC HEARINGS 1. Ordinance No. 330-77 - Kenai water Supply & Water Shed Protection 2. Ordinance No. 331-77 - Special Revenue Fund entitled "Airport P+axter Plan" S. Ordinance No. 332-77 - Increasing Pstimated Revenues & Appropriations/Airport Land 4. 5. C. PERSONS PRESENT SCHEDULED TO HE HEARD 1. Mr. Ted Carson - RF.: Rainbow Bar & Grill 2. Mr. Edward Garnett - RE; Lease Application/Andy's Flying Service S. Mr. Billy McCann - RF.: Assessments 4. Mr. William Hinrichs - RE: Resolution 77-27/Amending Zoning Ordinance 5. Mr. Tru McGrady - RE: 73-83 Assesaments 6. Crown Developers & Resolution No. 77-53 D. MWTES 1. Minutes of the regular meeting of March 16. 1977 E. CORRESPONDENCE 1. Rogers & Baldwin/Terminal Lease with Brian Peak 2. Alcoholic Beverage Control Board/Oaken Keg #54 Renewal Application 3. 4. F. OLD BUSINESS 1. Ord. 333-77 - Special Deterred Assesamente/Parsons Property 2. Resolution No. 77-29 - Refunds to Certain Property owners in 1973 Assess. Districts 3. Sale of FAA Building #107 0. NEW BUSINESS 1. Bills to be paid - bills to be ratified 2. Ord. 334-77 - Dedicating Certain Bond Funds to water & Sewer Improvements S. Ord. 335-77 - Authorizing Land Sale of Tax & Assessment Foreclosure Properties 4. Res. 77-45 - Transfer of Funds/Senior Citizen Nutrition Program 5. Rea. 77-46 - Transfer of Funds/Special Rleetion 6. Res. 77-47 - Ratifying Purchase & Installation of Water Pump 7, Res. 77-48 - Ratifying Payment of $5.000 to Hutchings Sales & Service 9. Res. 77-49 - Transfer of Funds/Kenai %voter Project 07-01-01684 - Change Ord. 7 -IN S. Res. 77-50 - Transfer of Funds/Airport Terminal Manager Rudget 10. Res. 77-51 - Transfer of Funds/Kenai Community Library RudPot H, Res. 77-52 - Transfer of Funds/City Manager's Budget 12. Awarding of Bid - Kenai Municipal Airport Janitorial Contract IS. Sublease of Lot S. Block 3. Cook Inlet Industrial Air Park 14. Assignment of Lease - Lot 8, Block 3. Cook Inlet industrial Air Park 15. 16. 17. H. REPORTS 1. City Manager's Report 2. City Attorney's Report S. Mayor's Report 4. City Clark's Report - 4tX (45ta, �� �"�" lS 7 7 5. Finance Director's Report S. Planning & Zoning Commission's Report T. Kenai Peninsula Borough Assembly's Report 1. PERSONS PRESENT NOT SCHEDULED TO BE HEARD I. ADJOURNMENT thaw 1LII 1A I V. I A. B. C. D E. F. O. H. 1. AGENDA REGULAR MPRTING - KFNAI CITY COUNCIL APRIL 6. 1977 - 8: 00 P.M. KENAI PUBLIC SAFETY BUILDING PLEDGE OF ALLEGIANCE ROIL CALL AGENDA APPROVAL PUBLIC HEARINGS 1. Ordinance No. 330-77 - Kenai Rater Supply & Water Shed Protection 2. Ordinance No. 331-77 - Special Revenue Fund untitled "Airport "+nster Plan" 3. Ordinance No. 332-77 - Increasing Fatimated Revenues & Appropriations/Airport Land \ 4. PERSONS PRESENT SCHEDULED TO RE HFARD 1. Mr. Ted Carson - RE: Rainbow Bar a Grill 2. Mr. Edward Garnett - RE; Lease Application/Andy's Flying Service S. Mr. Billy McCann - RF.: Assessments 4. Mr. William Hinrichs - RE: Resolution 77-27/Amending Zoning Ordinance 5. Mr. Tru McGrady - RF: 73-93 Assessments 5. Crown Developers & Resolution No. 77-53 MINUTES 1. Minutes of the regular meeting of March 16, 1977 CORRESPONDENCE 1. Rogers & Baldwin/Terminal Lease with Brian Peck 2. Alcoholic Beverage Control Board/Ookcn Keg #54 Renewal AppHoation 3. 4. OLD BUSINESS 1. Ord. 333-77 - Special Deferred AaseRsments/Pnrsons Property 2. Resolution No. 77-29 - Refunds to Certain Property nwnera in 1973 Assess. Districts S. Sale of FAA Building #107 NEW BUSINESS 1. Bills to be paid - bills to be ratified 2. Ord. 334-77 - Dedicating Certain Pond Funds to Water & Sewer Improvements 3. Ord. 335-77 - Authorizing Land Rale of Tax & Assessment Foreclosure Properties 4. Res. 77-45 - Transfer of Funds/Senior Citizen Rutrition Program 5. Res. 77-46 - Tranefor of Funds/Speeinl Flection 6. Res. 77-47 - Ratifying Purchase & Installation of water Pump 7. Res. 77-48 - Ratifying Payment of $5,000 to Hutchings Rales a Service 9. Res. 77-49 - Transfer of Funds/Kenai Water Project 07-01-01684 - Change Ord. 7 -IN 9. Res. 77-60 - Transfer of Funds/Airport Terminal Atnnager Rudget 10. Res. 77-51 - Transfer of Funds/Kenai Community Library Rudget H, Res. 77-52 - Transfer of Funds/City Manager's Budget 12. Awarding of Bid - Kenai Municipal Airport Janitorial Contract 13. 14. 15. 10. 17. REPORTS 1. City Manager's Report 2. City Attorney's Report S. Mayor's Report /% o 4. City Clerk's Report - Jw,A-CA1a.P 17i5Qo�µau 5. Finance Director's Report 6. Planning & Zoning Commission's Report T. Kenai Peninsula Borough Assembly's Report PERSONS PRRSENT NOT SCHEDULED TO BE HEARD 1. ADJOURNMENT 7 , ...�.�•�—ice ��fiilF'" �-._: �r :-.:: ... -' _. ` ... _ _:..-- ��+`-.- -_�-� � I I CITY OF KENAI I ORDINANCE NO. 330-77 AN ORDINANCE OF THE COUNCIL OF THE CITY OF KENAI, ALASKA, REGARDING WATER SUPPLY AND WATER SHED PROTECTION AND PROVIDING FOR ENFORCEMENT OF THE ORDINANCE OUTSIDE THE CITY LIMITS. WHEREAS, AS 29.04.037(b) authorizes a municipality to adopt ordinances to protect its water supply and water shed and to enforce them outside its boundaries, and WHEREAS, the City of Kenai derives its water supply from the Beaver Creek aquifer northeast of the City, and WHEREAS, the City without invoking its rights under provisions of AS 29.04.037(b) has no means of protecting its water supply, and WHEREAS, it to in the public interest to adopt an ordinance protecting its water supply by requiring notification of the City of a potential user to enable the City to obtain due consideration by the State of the City's needs for water. NOW, THEREFORE, be it ordained by the Council of the City of Kenai, Alaska, as follows: Section 1: There is hereby added to the Code of the City of Kenai, Alaska a new Article 8 of Chapter 17, such Article to read in its entirety as follows: ARTICLE 8 Beaver Creek (around Water System Notification Required Section 17-80: It shall be unlawful, without prior notification to the City of Kenai, for any person or other entity, to dig, build, drive, drill or in any other manner construct a water well or otherwise appropriate water from beneath the surface in the territory described and illustrated in Schedule A attached hereto and incorporated by reference. Form of Notification Section 17-81: Prior notice shall be given by filing a certified true copy of the application for water rights in the form and manner prescribed by the State of Alaska, Department of Natural Resources, Division of Lands, Water Resources Section, with the City Clerk, City of Kenai, within seventy-two (72) hours of appli- cation to the State of Alaska for water rights. a I. I-'"'" F._�. � --i" �' a•C77 i�u�4:.9 II, I I{II .IN II !1 .11111! CITY OF KENAI I ORDINANCE NO. 330-77 AN ORDINANCE OF THE COUNCIL OF THE CITY OF KENAI, ALASKA, REGARDING WATER SUPPLY AND WATER SHED PROTECTION AND PROVIDING FOR ENFORCEMENT OF THE ORDINANCE OUTSIDE THE CITY LIMITS. WHEREAS, AS 29.04.037(b) authorizes a municipality to adopt ordinances to protect its water supply and water shed and to enforce them outside its boundaries, and WHEREAS, the City of Kenai derives its water supply from the Beaver Creek aquifer northeast of the City, and WHEREAS, the City without invoking its rights under provisions of AS 29.04.037(b) has no means of protecting its water supply, and WHEREAS, it to in the public interest to adopt an ordinance protecting its water supply by requiring notification of the City of a potential user to enable the City to obtain due consideration by the State of the City's needs for water. NOW, THEREFORE, be it ordained by the Council of the City of Kenai, Alaska, as follows: Section 1: There is hereby added to the Code of the City of Kenai, Alaska a new Article 8 of Chapter 17, such Article to read in its entirety as follows: ARTICLE 8 Beaver Creek (around Water System Notification Required Section 17-80: It shall be unlawful, without prior notification to the City of Kenai, for any person or other entity, to dig, build, drive, drill or in any other manner construct a water well or otherwise appropriate water from beneath the surface in the territory described and illustrated in Schedule A attached hereto and incorporated by reference. Form of Notification Section 17-81: Prior notice shall be given by filing a certified true copy of the application for water rights in the form and manner prescribed by the State of Alaska, Department of Natural Resources, Division of Lands, Water Resources Section, with the City Clerk, City of Kenai, within seventy-two (72) hours of appli- cation to the State of Alaska for water rights. a i} t ORDINANCE NO. 330-77, Page 2 Penalty Section 17-83: Any person or entity violating the provisions of this Article shall be subject to a civil penalty of $300 for each offense. Each and every day such offense continues shall be deemed a separate violation. Section 2: City of Kenai Ordinance No. 289-76 is hereby repealed. Section 3: City of Kenai Ordinance No. 301-76 is hereby repealed. PASSED by the Council of the City of Kenai, Alaska this day of April, 1977. JAMES A. ELSON, MAYOR .ATTEST: Sue C. Peter, City Clerk •J FIRST READING: March 16, 1977 SECOND READING: Anril 6.1977 EFFECTIVE DATE: 1, 4� SCHEDULE "A" (AMENDED) The boundary line encompasses fifty-two (52) square miles of Beaver Creek Ground Water System and is totally within the Kenai National Moose Range. The boundary line begins on the Moose Range boundary between Section 31, T6N, R1011, Section 6, TSN, RIOW, where the Moose Range boundary west forms a corner with the Moose Range boundary north; thence, north, following the Moose Range westerly most boundary to a point on the north most border of Section 5, T7N, RIOW, where it intersects.the Moose Range boundary; thence, east along the northern border of Section 5 and 4, T7N, RlOW, approximately two (2) miles; thence, southeast approximately two and one-half (22) miles to a point of. intersection at Sections 10, 11, 14, 15, T7N, RIOW; thence, south-southwest approximately 1.4 miles to a point on the south most border of Section 15, T7N, RlOW, 1200, feet west of the intersection of Sections 15, 14, 23, 22, T7N, RIOW; thence, 300 feet south where the boundary turns southwest and passes through the east most border of Section 22, T7N, RIOW, approximately 1500 feet south of the intersection of Sections 15, 14, 23, 22, T7N, RIOW; thence, southwest through the northeast quarter into the southwest quarter of Section 23, T7N, RIOW, to a point on the south most border of Section 23, T7N, RIOW, ISOO feet from the corner intersection of Sections 23, 24, 25, 26, T7N, RlOW; thence, northeast passing through the most easterly border of Section 23, approximately 900 feet north of the intersecting corner of Sections 23, 24, 25, 26, T7N, RIOW; thence, bisecting the most southerly border of Section 24, TTN, RIOW; passing through the northeast quadrant of Section 2S, T7N, RIOW, to intersect the most westerly border of Section 30, T7N, R9W, approximately 300 feet south of the corner intersection of Sections 24 and 25, T7N,- RIOW, Sections 19 and 30, T7N, R9W; thence, approximately 4 SOO feet due east into Section 30, T7N, R9W; thence, due south bisecting the south most border of Section 30, T7y, R9W and passing into Section 31, T7N, R9W for approximately 900 feet due south; thence, southeast, intersecting the most westerly border of Section 32, T7N, R9W and proceeding east approximately 900 feet where it turns south-southwest and intersects the most southerly border of Section 32, T7N, R9W, approximately 300 feet east of the corner intersection of Sections 31, 32, T7N, R9W, and Section 5 and 6, T6N, R9W; thence, due south through the northwest quarter of Section 5, T6N, R9W approximately 1,SOO feet; thence, Turning southwest, intersecting the most easterly border of Section 6, UN, R9W, at a point approximately 2,000 feet south from the corner inter*ection of Sections 5 and 6, T6N, R9W and Sections 31.and 329 T7N, R9W; thence, through the southeast quadrant of Section 6, T6N; R9W, due southwest 2,100 feet; then, due south 900 feet; ` thence, southwest to intersect the most northerly border of �-� Section 7, T6N, R9W, approximately $00 feet west of the corner intersection of Sections 5, 60 7 and 8, T6N, R9W; thence, duo 11 I �9 • y+_sx.�s� _.. i south to the first major basin boundary approximately 500 feet west of the most westerly border of Section 8, T6N, R9W; thence, northwest to intersect the most westerly border of Section 7, UN, R911; passing straight northwest to intersect the most northerly border of Section 1, T6N, R10W, approximately 900 feet from the corner intersection of Sections 6 and 7, T6N, R9W, and I Sections 1 and 12, T6N, RlOW; thence, northwest intersecting the most easterly border of Section 1, T6N, R10W, approximately 2,100 feet north of corner intersection of Sections 1, 2, 11 and 12, TO, R10W; thence, west-southwest, intersecting the corner Intersection of Sections 2, 3,' 10, 9, UN, R1011; thence, aroximately 3,900 feet following the south most border of Section 3, TEN, R10W; thence, due south-southwest intersecting the most easterly border of Section 10, TO, RlOW, approximately 1,200 feet north of corner intersection of Sections 9, 10, 15 and 16, UN, R10W; thence, south-southwest intersecting the most southerly border of Section 21, TO, R10W, approximately 1,800 feet west of the most easterly border of Section 21, TO, R9W; passing through the northwest quadrant of Section 28, UN, R10W, intersecting the most westerly border of Section 28, TO, RlOW, approximately 1500 feet south of intersecting corner, Sections 20, 21, 28 and 29, TO, R10W; thence, 1.14 miles due west intersecting the most easterly border of Section 30, UN, R10W, approximately 2,000 feet south of intersecting corner of Sections 19, 20, 29 and 30, T6N, R10W; thence, due south, intersecting the Moose Range boundary approx- imately one and one-half (IN) miles east from intersecting corner of Sections 28, 29, 32 and 33, UN, R10W; thence, west to the point of beginning. I V— � 1. – - -- - , - – -,% --------- W -A A, 'ANAW Ifaim 40 Icing Beaver k 61 pistfom 0 Cla _7 Oil Plallm. As Doltivaidefto 1p al Flatform AO Z' '0.. n1f A ral"I 'S Oil liuvormco '000' 4P% V 0-1 "100 0": • (Divo . . ' I-- , '. U -i East Foireli.d•jI U, t2i .4 '•' — oi..ev A l, 9fpC••ta ;. irk' N arm .4, law C Mbblua No I T v Y ...«+�.i'''� � ^'�. ..•c • 7�� j b A "lAke 40 06 amatof Us IT ry 9 VAj VX 1% 06, Loake IL 'C GVI*Unj- ujjar A- J, PPP' k ..ti 0 -1- Sol, IQ u r; - A4 % J' PIP d&-oldotnnyi 0 ..A • W04 Point q , p r f r • Slikok :7 Lake r, 3 PIP • Aj leau&hky 6"' 40 elvj'c4at Crak L --z I M. hip. 'Zlr4 k e J-7 IA4# Ilk I l CITY OF KENAI ORDINANCE NO. 331-77 AN ORDINANCE OF THE COUNCIL OF THE CITY OF KEN. -U, ALASKA, ESTABLISHING A SPECIAL REVENUE FUND ENTITTED "AIRPORT MASTER PLAN" AND BY INCREASING ESTIMATED REVENUES AND APPROPRIATIONS IN THE AMOUNT OF $123,159 WHEREAS, the City of Kenai has been awarded a grant in the amount of $123,159 for the purpose of compiling a Comprehensive Airport Master Plan, and WHEREAS, this project will not be completed in this current fiscal year, it is desirable to establish a separate fund, and WHEREAS, proper accounting practices require that all appropriations of City monies be made by ordinance. NOW, THEREFORE, BE IT ORDAINED by the Council of the City of Kenai, Alaska, that a special revenue fund entitled "Airport Master Plan" be established to reflect the following transfers and increases in estimated revenues and appropriations. Airport Terminal Manager From: Professional Services ($3,849) To: Transfers $ 3,849 c Special Revenue Fund - Airport Planning Grant Increase Estimated Revenues: Interfund Receipts Airport Terminal $ 3,849 State of Alaska 3,848 { Federal Aviation Administration 115,462 Increase Appropriations: Professional Services 123,159 k- r -- -- - - _BEA -_i r Y ORDINANCE NO. 331-77, Page Two PASSED by the Council of the City of Kenai, Alaska, this day of April, 1977. JAMES A. ELSON, MAYOR ATTEST: Sue C. Peter, City Clerk FIRST READING: *'►Arch 10, 1977 SECO" READING: April 6, 1977 EFFECTIVE DATE: _I i I I � f + i r: k + • d i i i I CITY OF KENAI ORDINANCE NO. 332-77 AN ORDINANCE. OF THE COUNCIL OF THE CITY OF KENAI, ALASKA, INCREASING ESTIMATED REVENUES AND APPROPRIATIONS IN THE AIRPORT LAND FUNT) IN THE AMOUNT OF $3, 010 FOR THE PURPOSE OF REPAIRING THE OVERHEAD DOORS IN THE WARM STORAGE FACILITY. WHEREAS, the City has constructed a warm storage facility for winter storage of City heavy equipment at a cost of $47,500, and WHEREAS, the overhead doors have become misaligned and extensive damage to the facility is eminent if the doors are not repaired, and WHEREAS, revenues in the Airport Land Fund have exceeded the estimate in sufficient amounts to fund the necessary repairs. NOW, THEREFORE BE IT ORDAINED by the Council of the City of Kenai, Alaska, that the following increases in estimated revenues and appropriations be made: 1976-77 Airport Land Fund Budget Increase Estimated Revenues: Rents & Leases $3,010 Increase Appropriations: Warm Storage Facility $3,010 PASSED BY THE COUNCIL OF THE CITY OF KENAI, ALASKA, this day of April, 1977. ATTEST., Sue C. Peter, City Clerk JAMES A. ELSON , MAYOR FIRST READING: Alarch 16, 1977 SECOND READING: April 6, 1977 EFFECTIVE DATE: _^_.. _:.... ... -. '�waow.�l.w �,•q1,i� _,J.�_� .. _J 911 III 1111111 &icaiaYdw� A&,Mr .a -Z. ��� .�lae�iv 99677 Telep mms 907 - 288.7189 March 18, 1977 Mayor James A. Elson Kenai City Council City of Kenai Kenai, Alaska 99611 Re: Lease Application: Lot Four (4), Block Five (5) GENERAL AVIATION David L. Diamond Dear Mayor Elson: This office has been retained by Mr. Diamond to represent him in his application to the City for a 55 year lease on Lot Four (4), Block Five (5), General Aviation. It appears that the Council at its last meeting on March 16, 1977 rejected Mr. -Diamond's application. Please be advised that Mr. Diamond is petitioning the Council for reconsideration of their rejection of his application for a lease and respectfully requests a rehearing at the next meeting of the City Council. Sincerely, &.e.e, AeAW� EDWARD L. GARNETT ELG/jlb cc: Mr. David Diamond -: - -_- - -V MINUTES KENAI CITY COUNCIL SPECIAL MEETING i JANUARY 30, 1974 8:00 P.M. KENAI LIBRARY I r ' The Council gave the Pledge of Allegiance. v.. ROLL CALL: Members present - A. L. Hudson, Tru McGrady, Robert Norene, H. J. 4 t : Steiner and Mayor John Stoinbeck. Members absent - C. E. Johnson (excused) and James Doyle, B: PUBLIC HEARINGS IB- 1: Final Assessment Rolls on the followinq Special Assessment Districts: Water Districts: Sewer Districts; District 40 73 -SI 73 -WI 73-53 73-W2 73-S4 73-W3 73-W4 73 -WS There was no objections to having the public hearings on all the districts at one time. Mayor Steinbeck recessed the meeting and opened It up for a public hearing, He asked each to state their name and the district he Is concerned with. i { „Billy McCann stated a.prl�v#te,contractor came in and built. a sewer line for live persons to connect with the City's line, Bruce Massey told us it would cost us 1%. Mayor Steinbeck stated he talked with Bruce on this on the phone and he would put this In writing. They were to be charged 1% of the normal assessment. i ' Mr. Glad asked If the hook-up fee Is going to be contracted at a later date and Is It going to be amortized over a ten year period. i The City Manager stated the hook-up fee will be offered for all the districts. The Council can authorize it to be amortized over 10 years but It is not set up that way now. j f - e!o.�iaa�uw'!'u.iviia... ioui 1 i i mniu7 0 I r CITY OF KENAI RESOLUTION NO. 77-53 a A RESOLUTION OF THE COUNCIL OF THE CITY OF KENAI. ALASKA, PRO- VIDING FOR WAIVER OF PENALTY AND FORECLOSURE ACTION RELATIVE TO PROPERTIES SUBJECT TO WATER AND SEWER ASSESSMENTS OWNED BY CROWN DEVELOPERS. WHEREAS, Crown Developers have petitioned the Council by letter dated March 30, 1977 and incorporated herein by reference for waiver of penalty and foreclosure action on water and sewer assessment payments due April 1, 1977, on their properties, and WHEREAS, such a waiver of penalty and foreclosure action appears appropriate under the circumstances due to the large number of parcels involved. NOW, THEREFORE, BE IT RESOLVED by the Council of the City of Kenai, Alaska, that Crown Developers are hereby granted a waiver of penalty and fore- closure action until August 30, 1977, for all properties held in their name as of January 1, 1977. PASSED by the Council of the City of Kenai, Alaska, this Sth day of April, 1977. t JAMES A. ELSON, MAYOR f ATTEST: 1 I t Sue C. Peter, City Clerk a I � L 1 ' �I el - - - -- - - - - ----- -- - - - CROWN DEVELOPERS 345 West 6th, Suite 202 Anchorage, Alaska 99501 March 30, 1977 City of Kenai Box 580 Kenai, Alaska 99611 Attn: Mr. John Wise, City Manager Dear Mr. Wise: Please consider this a formal request to defer payment on assessments due on our lots located in Mommsen Subdivision and an adjoining 77 acres. Main points for this request are outlined as follows: (1) We formed a partnership with Bob Dow, Sr. dba B.O.B.,Corp. to develop Mommsen Subdivision and adjoining 77 acres. We thereby assumed his liabilities but a title report at that time failed to show a law suit with a Lis Pendens or the pending water and sewer assessments. (2) The Lis Pendens served to cloud the title and stopped any further development. No sales means no revenue. (3) Mr. Bob Dow, Sr., has now died. (4) The law suit is scheduled to go to court on May 2, 1977., thereby clearing title and allowing us to resume develop - went. (5) Small Business Administration has a loan outstanding and has agreed to give us a moratorium on payment of install- ments thru September 10, 1977 - per attached letter to S.B.A. and their reply. Once we obtain clear title, we propose to sell existing improved lots and bring all creditors current, then improve all unimproved land. We have builders ready to build. The result will be increased housing and increased tax revenues. Construction alone will give some benefit to the Kenai community. We request a deferment of assessments and that the 10% penalty -- not be applied through August 30, 1977. This deferment would allow court action and thus with a clear title we could either borrow the j funds or sell sufficient lots to bring our account current. In the extreme instance the May 2nd court hearing does not remove the cloud City of Kenai -2- March 30, 1977 on the title, the period from May 2 to August 30, would give us adequate time to liquidate other assets. In any event, if the City can give us some additional time, we will bring our account current. Very truly yours, CROWN DEVELOPERS Kenneth R. Padgett KRP/t Enclosures W t REGULAR mrF.TINO - KFNAI CITY COUNCIL MARCII IG. 1977 - 7: 00 P.P1. KENAI PUBLIC SAFETY BUIi.DING PLEDGE OF ALLEGIANCE PAGE. ADJOURNMFNT - LAND SALE RECONVENE - 8:00 P.M. - REGULAR MEETING A. ROLL CALL AGENDA APPROVAL f 1 � 1 1. Ordinance No. 328-77 - Charter Amendment. Special Assessments 1 i 2. Ordinance No. 329-77 - Declaring FAA Rutlding ¢107 Surplus 2 REGULAR mrF.TINO - KFNAI CITY COUNCIL MARCII IG. 1977 - 7: 00 P.P1. KENAI PUBLIC SAFETY BUIi.DING PLEDGE OF ALLEGIANCE PAGE. ADJOURNMFNT - LAND SALE RECONVENE - 8:00 P.M. - REGULAR MEETING A. ROLL CALL AGENDA APPROVAL B. PUBLIC HEARiNGS 1. Ordinance No. 328-77 - Charter Amendment. Special Assessments 1 2. Ordinance No. 329-77 - Declaring FAA Rutlding ¢107 Surplus 2 S. Renewal of Beverage Dispensary License - Rainbow Par a Orifi 3 4. Renewal of Beverage Dispensary License - Kenai .toe's 3 5. Renewal of Beverage Dispensary License - Pre -Flight Room 3 6. Renewal of Beverage Dispensary License - Harbor View 4 C. PERSONS PRESENT SCHFDULED TO RF HF.ARO 1. 2. D. MINUTES 1. Minutes of the regular meeting of March 2, 1877 4 E. CORRESPONDENCE. 1. Salvation Army - Peninsula Corps 4 2. 8. 4. F. OLD BUSINESS jl. Lease Agreement - Old Kenai Library Building 4 2. Payment to Engineer - FDA Water Project No. 07-01-01684 6 8. O. NEW BUSINESS 1. Bills to be paid - bills to be ratified 6 2. Ordinance No. 330-77 - Kenai Water Supply 8 tenter Shed Protection 5 3. Ordinance No. 331-77 - Specini Revenue Fund entitled "Airport Master Plan" 5 4. Ordinance No. 332-77 - increasing Estimated Revenues G Appropriations/Airport Land 5. Resolution No. 77-27 - Amending Kenai Municipal District Zone Code 8 0. Resolution No. 77-28 - waiving Interest 6 Extending Period of Deferment 7 7. Resolution No. 77-28 - Authorizing Refunds to Certain Property Owners 8 8. Resolution No. 77-30 - Addition to Sr. Citizen Nutritional Program 8 0. Resolution he. 77-31 - Contract/Airport Alaater Plan Study 8 10. Resolution No. 77-32 - Forest Drive Water Line Project 11. Resolution No. 77-33 - donation to Kenai Community Library 9 12. Addendum to AAI Lease - Car Rental Service 0 18. Resolution 77-34 - Senior Citizen Budget Program 8 14. Resolution 77-35 - Limit Tort Liability of P+unieipalities 10 16. Resolution 77-36 - Step 41 Sewerage Treatment Study Application 10 10. Resolution 77-37 - Execute Step #1 G Step #2/Sowerage Planning Study 10 17. Lease of Airport Lands or Facilities - Andy's Flying Service 18. Payment Estimate #5 - interstate Construction 12 10. Periodic Estimate #6 - Brown Construction Company 12 20. H. REPORTS , 1. City Manager's Report 12 2. City Attorney's Report 13 S. Mayor's Report 12 4. City Clerk's Report 13 5. Finance Director's Report 14 0. Planning d Zoning Commission's Report 16 7. Kenai Peninsula Borough Assembly's Report IS I. PERSONS PRESENT NOT SCHEDULED TO RE HEARD ADJOURNMENT I KENAI CITY COUNCIL - REGULAR MEETING MARCH 16, 1977 - 8: 00 P.M. 3� KENAI PUBLIC SAFETY BUILDING MAYOR JAMES A. ELSON PRESIDING 1 PLEDGE OF ALLEGIANCE A . ROLL CALL Present: Tom Ackerly, Edward Ambarian, Dan Whelan, Richard Morgan, Betty Glick and James Elson _I Absent: Walter Sweet ' AGENDA APPROVAL The following items were approved for addition to the agenda: 0-13: Resolution No. 77-34 - Senior Citizen Program Budget G-14: Resolution No. 77-35 - Limit Tort Liability of Municipalities 0-15: Resolution No. 77-36 - Step #1 Sewerage Treatment Study Application G-16: Resolution No. 77-37 - Execute Step #1 & Step #2/Sewerage Planning Study G-17: Lease of Airport Lands or Facilities - Andy's Flying Service 0-18: Payment Estimate #5 - Interstate Construction 0-19: Periodic Estimate #6 - Brown Construction Company B. PUBLIC HEARINGS B-1: Ordinance No. 328-77 - Charter Amendment, Special Asssessments I. Mayor Elson read Ordinance No. 328-77 by title only. "An ordinance of the Council of the City of Kenai, Alaska, providing for the submission of charter amendments concerning special assessments to the qualified voters of the City at a special election to be held , 1977." Mayor Elson opened the hearing to the public. Mrs. Ruby Coyle - Mrs. Coyle objected to the ordinance as she felt it was not in compliance with Title 29. Also Mrs. Coyle objected to Section 6-4 as there was alr a Section 6-4 contained in the charter. Janis Williams, City Attorney, advised that the ordinance could be amended to reflect the addition of a new Section 6-5 and fur advised that Section 6-4 was amended in an election held November 4, 1969. s There being no further comment from the public, Mayor Elson returned the hearinj to the Council table for action. F- KENAI CITY COUNCIL, REGULAR MEETING, MARCH 16, 1977 Page 2 ► '._ Councilman Morgan stated that the intent of this ordinance was to provide the capability for forming assessment districts this coming construction season, however, if this t was not feasible with regard to bond sales, perhaps the City should postpone the a charter amendments until the regular election this fall. Mr. Wise advised that the City could give no assurance that the bonds could be sold. Mayor Elson stated that he felt there was a significant factor that has not carried the emphasis it should with regard to the intent behind proposing this charter change. i Mayor Elson further stated that in the past taxes have continued to rise due to improve- ments the City has had to make within the City and because of the 25% limitation, those property owners who do not benefit from the improvements have had to help carry the burden. Mayor Elson stated he felt that this ordinance will alleviate the general tax payer from carrying the burden of the costs. Mayor Elson stated that the only question that really remains is does this change require a special election -- the Council should look at the long range view. Mayor Elson stated that if the City is to have any additional improvements, it was his opinion that the 25% limitation requirements be relaxed. Council had considerable discussion with regard to the water/sewer fund and whether or not it was self-supporting. Finance Director Kinney advised that the Special Assess- ment Fund owed the General Fund over $108, 000. MOTION: Councilman Ambarlan moved, seconded by Councilwoman Glick, for adoption of Ordinance No. 328-77, providing for the submission of Charter amendments concerning special assessments to the qualified voters of the City at a special election, as amended Including Sections 6-5 and 7-4 and the date of such election to be held May 17, 1977. Motion passed unanimously by roll call vote. B-2: Ordinance No. 329-77 - Declaring FAA Building 0107 Surplus Mayor Elson read Ordinance No. 329-77 by title only as copies were available for the public. "An ordinance of the Council of the City of Kenai, Alaska, declaring FAA Building No. 107 surplus and directing that it be sold at public auction." Mayor Elson opened the hearing to the public. There was no public input, therefore, the hearing was returned to the Council table. MOTION: Councilman Ambarian moved, seconded by Councilman Whelan, for adoption of Ordinance No. 329-77 declaring FAA Building No, 107 surplus and directing that it be sold at public auction. Motion passed unanimously by roil call vote. [M L i s RE KENAI CITY COUNCIL, REGULAR MEETING, MARCH 16, 1977 B-3: Renewal of Beverage Dispensary License - Rainbow Bar & Grill Page 3 Administration advised that the Rainbow Bar & Grill were delinquent in their sales tax in the amount of $12,882, delinquent in personal property taxes and 1977 personal property not filed as of this date. Mayor Elson opened the hearing to the public. There was no comment. MOTION: Councilman Morgan moved, seconded by Councilman Ambarian, that the Council of the City of Kenai request that the Alcoholic Beverage Control Board withhold issuance of renewal of license for beverage dispensary for the Rainbow Bar & Grill until all taxes are current. Notion passed unanimously by roll call vote. B-4: Renewal of Beverage Dispensary License - Kenai Joe's Administration advised that sales taxes were delinquent in the amount of $6,930, Personal Property taxes were delinquent and not filed for 1977 and City assessments in the amount of $255.39 were also delinquent for Kenai Joe's. Mayor Elson opened the hearing to the public. There was no comment. MOTION: Councilman Ambarian moved, seconded by Councilman Ackerly, that the Council of the City of Kenai request the Alcoholic Beverage Control Board to withhold issuance of renewal of license for beverage dispensary for Kenai Joe's until all taxes are current. Motion passed unanimously by roll call vote. B-5: Renewal of Beverage Dispensary License - Pre -Flight Room Administration advised that all taxes were current for the Pre -Flight Room. Mayor Elson opened the hearing to the public. There was no public input. MOTION: Councilman Ambarian moved, seconded by Councilman Ackerly, that the Council of the City of Kenai request the Alcoholic Beverage Control Board to withhold issuance of renewal of beverage dispensary license for the Pre -Flight Room as they refuse to pay the current lease rate as set by City ordinance. Motion passed by roll call vote. Voting yes; Ackerly, Ambarian, Morgan, Glick and Elson. Voting no; Whelan. 0 --V— KENAI CITY COUNCIL, REGULAR MEETING, MARCH 16, 1977 Page 4 i -� B-6: I � Renewal of Beverage Dispensary License - Harbor View i Administration advised that all taxes, payments to the City, etc. were current for the Harbor View. i i Mayor Elson opened the hearing to the public. There was no comment. There was no objection to the issuance of beverage dispensary license to the Harbor View. C. PERSONS PRESENT SCHEDULED TO BE HEARD None D. MINUTES D-1: Minutes of the regular meeting of March 2, 1977 The minutes were approved as distributed E. CORRESPONDENCE E -i: Salvation Army Mayor Elson acknowledged receipt of a letter from the Salvation Army thanking the City Council for their consideration in the matter of lease of the old library building. E-2: Mayor Elson advised that he had received a copy of a "Profile Study of five Kenai Peninsula Cities" and this copy would be available at the Clerk's office. F. OLD BUSINESS F-1: Lease Agreement - Old Kenai Library Building _ Councilman Morgan questioned the term of lease in that it was for only one year. Mr. Wise advised that the Historical Society had requested a short term lease so that they would not be bound to a lengthy lease in the event their organization ran into problems with the rental of the building. MOTION: Councilman Morgan moved, seconded by Councilman Whelan, for approval of lease to the Kenai Historical Society for building located on Lot 3, Block 17, Original Townsite of Kenai, which formerly housed the Kenai Community Library for a term of one year at the annual rental rate of $1.00. Motion passed unanimously by roll call vote. KENAI CITY COUNCIL, REGULAR MEETING, MARCH 16, 1977 F-2: Payment to Engineer - EDA Water Project No. 07-01-01684 _ .. - -------- - - _,G----------_s--r_ Page 5 MOTION: Councilman Ambarian moved, seconded by Councilman morgan, for approval of of payment to Harold H. Galliett, Jr. for professional engineering services on EDA Project No. 07-01-01684 in the amount of $16,423.99. Councilman Morgan stated that he objected very strongly that the Change Orders went so far without Council approval -- feel City should pay the engineer for time spent but Council should have the opportunity to make all future decisions concerning the changes prior to expenditure of monies involving engineering time, etc. Motion passed unanimously by roll call vote. G. NEW BUSINESS G-1: Bills to be paid - bills to be ratified MOTION: Councilman Whelan moved, seconded by Councilman Morgan, for approval of bills to be paid and bills to be ratified as listed 3/16/77. Motion passed unanimously by roll call vote. G-2: Ordinance No. 330-77 - Kenai Water Supply & Water Shed Protection Mayor Elson read Ordinance No. 330-77 by title only. "An ordinance of the Council of the City of Kenai, Alaska, regarding water supply and water shed protection and providing for enforcement of the ordinance outside the City limits". Mayor Elson advised that this ordinance differed from the first ordinance with regard to the some subject in that it provides for notice to the City rather than permission from the City. MOTION: Councilman Morgan moved, seconded by Councilman Whelan, for introduction of Ordinance No. 330-77, regarding water supply and water shed protection and providing for enforcement of the ordinance outside the City limits. Motion passed unanimously by roll call vote. G-3: Ordinance No. 331-77 - Special Revenue Fund Entitled "Airport Master Plan" Mayor Elson read Ordinance No. 331-77 by title only as copies were available for the public. "An ordinance of the Council of the City of Kenai, Alaska, establishing a special revenue fund entitled "Airport Master Plan" and by increasing estimated revenues and appropriations in the amount of $123,159." 3 KENAI CITY COUNCIL, REGULAR tMETING, MARCH 16, 1977 MOTION: Page 6 Councilman Morgan moved, seconded by Councilman Ackerly, for introduction of Ordinance No. 331-77, establishing a special revenue fund entitled "Airport Alaster Plan" and by increasing estimated revenues and appropriations in the amount of j' $123,159. y. Motion passed unanimously by roll call vote. i G-4: Ordinance No. 332-77 - Increasing Estimated Revenue & Appropriations/Airport Land Mayor Elson read Ordinance No. 332-77 by title only as copies were available for the public. "An ordinance of the Council of the City of Kenai, Alaska, increasing estimated revenues and appropriations in the Airport Land Fund in the amount of $3,010 for the purpose of repairing the overhead doors in the warm storage facility." Mr. Wise advised that the overhead doors in the warm storage facility had been damaged and no funds were provided for their repair in the budget -- thus the reason for the ordinance. I MOTION: Councilman Whelan moved, seconded by Councilman Ackerly, for introduction of Ordinance No. 332-77, increasing estimated revenues and appropriations in the Airport Land Fund in the amount of $3, 010 for the purpose of repairing the overhead -� doors in the warm storage facility. i Motion passed unanimously by roll call vote. 0-5: Resolution No. 77-27 - Amending Kenai Municipal District Zone Code Mayor Elson read Resolution No. 77-27 by title only as copies were available for the public. "A resolution of the Council of the City of Kenai, Alaska, recommending amendment of the Kenai Municipal District Zoning Code, Chapter 21.76, Kenai Peninsula Borough Code of Ordinances." Mr. Wise advised that the Kenai Advisory Planning & Zoning Commission had recommended these changes be made and the most significant change was that the ordinance be amended to include that there would be single family dwellings exclusive within rural residential and suburban residential zones. Mayor Elson reminded Council that passage of this resolution would not mean actual j change in the zoning but merely that the matter be brought before the Borough for consideration. r MOTION: Councilwoman Glick moved, seconded by Councilman Morgan, for adoption of Resolution No. 77-27, recommending amendment of the Kenai Municipal District Zoning Code, Chapter 21.76, Kenai Peninsula Borough Code of Ordinances. KENAI CITY COUNCIL, REGULAR MEETING, MARCH 16, 1977 Page 7 Councilman Ambarian suggested that consideration be given to make the language ^� clearer with regard to 2-1/2 stories or 35 feet references for contractors building j within the City. QUESTION: Motion passed by -roll call vote. Voting yes; Ackerly, Whelan, Glick, Morgan and Elson. Voting no; Ambarian. G-6: Resolution No. 77-28 - Waiving Interest a Extending Period of Deferment ' Mayor Elson read Resolution No. 77-28 by title only. "A resolution of the Council of the City of Kenai, Alaska, waiving interest in a deferred assessment and extending the period of deferment." Councilman Ambarian questioned the legality of not presenting this matter at a public hearing? City Attorney Williams stated that in order to grant the Parson's requests in regard to deferred assessments, an ordinance would be required because in effect the Council would be exempting them from the provisions as specified in Ordinance No. 314-76. MOTION: Councilman Ambarian moved that Resolution No. 77-28 be introduced as an ordinance at the next meeting of the Kenai City Council. Motion died for lack of second. Councilman Whelan asked the City Attorney's opinion as to the question which arises by the letter sent to the Parsons by prior Administration. City Attorney Williams stated that Administration has no authority other than that delegated by Council and, therefore, to unable to bind the Council to any commitments without their approval. Councilman Morgan stated that he did not agree with the resolution nor Ordinance 314-76 as the letter from the Parsons was not presented to Council at passage of the ordinance. Councilman Morgan further commented that he felt the City had a moral obligation to persons having been given special commitments from City Administration, iand perhaps a similar resolution could be drafted including that after the deferred period, interest would be charged and at such time that the property is subdivided, the assessments would be due and payable. Also, Councilman Morgan objected to the I reference in the resolution "Parsons family" as he felt the reference should be limited to Ruth and/or Hedley Parsons only. ! MOTION: Councilman Ambarian moved, seconded by Councilman Morgan, to table Resolution No. 77-28 and Administration be so instructed to return with an ordinance that would affect the large property owners. Motion passed unanimously. i� x r i� FA A�- �"_'e'-i�. j KENAI CITY COUNCIL, REGULAR MEETING, MARCH 16, 1977 Page 8 i 0-7: Resolution No. 77-29 - Authorizing Refunds to Certain Property Owners Mayor Elson read Resolution No. 77-29 by title only. "A resolution of the Council of the City of Kenai, Alaska, authorizing refunds to certain property owners in the 1973 assessment districts." Mr. Wise requested that this resolution be tabled as he has received comments that Kenai Property Owners may initiate further proceedings against the City and, therefore, this resolution may be pre -mature. MOTION: Councilman Whelan moved, seconded by Councilman Ackerly, to table Resolution No. 77-29, authorizing refunds to certain property owners. Motion passed by roll call vote. Voting yes; Ackerly, Whelan, Morgan, Glick and Elson. Voting no; Ambarian . G-8: Resolution No. 77-30 - Addition to Sr. Citizen Nutritional Program Mayor Elson read Resolution No. 77-30 by title only. "A resolution of the Council of the City of Kenai, Alaska, providing for a "!Beal on Wheels" addition to the Senior Citizen Nutritional Program." Mr. Wise advised that funds were available to provide this service to those senior citizens who are housebound. MOTION: Councilman Whelan moved, seconded by Councilwoman Glick, for adoption of Resolution No. 77-30, providing for a "Meal on Wheels" addition to the Senior Citizen Nutritional Program. Motion passed unanimously by roll call vote. 0-9: Resolution No. 77-31 - Contract/Airport Master Plan Study Mayor Elson read Resolution No. 77-31 by title only. "A resolution of the Council of the City of Kenai, Alaska, providing for a contract to execute the Airport Master Plan study." MOTION: Councilman Morgan moved, seconded by Councilman Ackerly, for adoption of Resolution No. 77-31, providing for a contract to execute the Airport Master Plan Study. Motion passed unanimously by roll call vote. I KENAI CITY COUNCIL, REGULAR MEETING, MARCH 16, 1977 Page 9 G-10: Resolution No. 77-32 - Forest Drive Water Line Project Mayor Elson read Resolution No. 77-32 by title only. " A resolution of the Council of the City of Kenai, Alaska, authorizing the acceptance of the amended grant on the i. Forest Drive Water Line Project in the amount of $105,334." MOTION: Councilman Morgan moved, seconded by Councilman Ackerly, for adoption of Resolution No. 77-32, authorizing the acceptance of the amended grant on the Forest Drive Water Line Project in the amount of $105,334. Motion passed unanimously by roll call vote. G-11: Resolution No. 77-33 - Donation to Kenai Community Library Mayor Elson read Resolution No. 77-33 by title only. "A resolution of the Council of the City of Kenai, Alaska, accepting the donation of a 3-M Microfiche Reader to the Kenai Community Library from the Kenai Lions Club. MOTION: Councilman Ackerly moved, seconded by Councilwoman Glick, for adoption of - Resolution No. 77-33, accepting the donation of a 3-M Microfiche Reader to the Kenai Community Library from the Kenai Lions Club. Motion passed unanimously by roll call vote. G-12: Addendum to AAI Lease - Car Rental Service Administration advised that this lease would authorize AAI to operate a car rental business in which the City would receive 10% of the gross receipts on rental transactions and 135 of gross receipts from the sale of personal accident insurance. MOTION: Councilman Morgan moved, seconded by Councilman Whelan, for approval of addendum to Alaska Aeronautical Industries, Inc. lease dated February 1, 1977 to allow AAI to operate National Car Rental Agency in the Airport Terminal Building. Motion passed unanimously by roll call vote. G-13: Resolution No. 77-34 - Senior Citizen Budget Program Mayor Elson read Resolution No. 77-34 by title only. "A resolution of the Council of the City of Kenai, Alaska, approving the attached Senior Citizens Program Budget and authorizing the City Manager to apply in behalf of the City for State and Federal Assistance to implement the program." 1 f KENAI CITY COUNCIL, REGULAR MEETING, MARCH 16, 1977 Page 10 MOTION: -'� Councilwoman Glick moved, seconded by Councilman Whelan, that the City *tanager is hereby authorized and directed to submit an application to the State of Alaska 1 for Title III and Title VII, Senior Citizen Programs, in the gross amount of $171,098 and that a 25% share of Title III and a 10% share of Title VII shall be funded by the City in support of this program benefitting the Greater Kerai Area. Motion passed unanimously by roll call vote. G-14: Resolution No. 77-35 - Limit Tort Liability of %luntelpalities Mayor Elson read Resolution No. 77-35 by title only. "A resolution of the Council of the City of Kenai, Alaska, petitioning the Kenai Peninsula Legislative Delegation to sponsor and enact legislation to limit tort liability of the municipalities". Mr. Wise advised that recent State Supreme Court decisions have held municipalities liable for failure to fully exercise and implement inspection procedures which threatens the legal liability of each municipality. MOTION: Councilman Morgan moved, seconded by Councilman Whelan, for adoption of Resolution No. 77-35, petitioning the Kenai Peninsula Legislative Delegation to sponsor and enact legislation to limit tort liability of the municipalities. Motion passed unanimously by roll call vote. G-15: Resolution No. 77-36 - Step A Sewerage Treatment Study Application Mayor Elson read Resolution No. 77-36 by title only. " A resolution of the Council of the City of Kenai, Alaska, authorizing and directing the City ".,Tanager to make application for a Step 0 Sewerage Treatment Study." MOTION: Councilman Morgan moved, seconded by Councilwoman Glick, for adoption of Resolution No. 77-36, authorizing the City Manager to make application to the EPA for a Step 01 Sewerage Planning Grant in the amount of $82,640, and execute the necessary grant agreements and other documents as required. Motion passed unanimously by roll call vote. 0-16: Resolution No. 77-37 - Execute Step #1 & Step #2/Sewerage Planning Studv Mayor Elson read Resolution No. 77-37 by title only. "A resolution of the Council of the City of Kenai, Alaska, for a contract to execute a Step #1 Sewerage Planning Grant and a Step #2 Grant application." q4 7 -.r Page 10 MOTION: -'� Councilwoman Glick moved, seconded by Councilman Whelan, that the City *tanager is hereby authorized and directed to submit an application to the State of Alaska 1 for Title III and Title VII, Senior Citizen Programs, in the gross amount of $171,098 and that a 25% share of Title III and a 10% share of Title VII shall be funded by the City in support of this program benefitting the Greater Kerai Area. Motion passed unanimously by roll call vote. G-14: Resolution No. 77-35 - Limit Tort Liability of %luntelpalities Mayor Elson read Resolution No. 77-35 by title only. "A resolution of the Council of the City of Kenai, Alaska, petitioning the Kenai Peninsula Legislative Delegation to sponsor and enact legislation to limit tort liability of the municipalities". Mr. Wise advised that recent State Supreme Court decisions have held municipalities liable for failure to fully exercise and implement inspection procedures which threatens the legal liability of each municipality. MOTION: Councilman Morgan moved, seconded by Councilman Whelan, for adoption of Resolution No. 77-35, petitioning the Kenai Peninsula Legislative Delegation to sponsor and enact legislation to limit tort liability of the municipalities. Motion passed unanimously by roll call vote. G-15: Resolution No. 77-36 - Step A Sewerage Treatment Study Application Mayor Elson read Resolution No. 77-36 by title only. " A resolution of the Council of the City of Kenai, Alaska, authorizing and directing the City ".,Tanager to make application for a Step 0 Sewerage Treatment Study." MOTION: Councilman Morgan moved, seconded by Councilwoman Glick, for adoption of Resolution No. 77-36, authorizing the City Manager to make application to the EPA for a Step 01 Sewerage Planning Grant in the amount of $82,640, and execute the necessary grant agreements and other documents as required. Motion passed unanimously by roll call vote. 0-16: Resolution No. 77-37 - Execute Step #1 & Step #2/Sewerage Planning Studv Mayor Elson read Resolution No. 77-37 by title only. "A resolution of the Council of the City of Kenai, Alaska, for a contract to execute a Step #1 Sewerage Planning Grant and a Step #2 Grant application." q4 7 F_ KENAI CITY COUNCIL, REGULAR MEETING, 1v1ARCII 16, 1877 Page 11 MOTION: Councilman Morgan moved. seconded by Councilman Whelan, for adoption of Resolution No. 77-37, for approval of a contrnet to execute a Step #1 Sewerage Planning Grant and a Step 02 grant application. Motion passed unanimously by roll call vote. 11-17: Lease of Airport Lands or Facilities - Andy's Flying Service Mr. Wise advised that this lease to Andy's Flying Service was for Lot 4, Block 5, General Aviation Apron, for a term of 55 years at the annual rental of $1,166.50 and was to be utilized as aircraft tie -downs, aircraft maintenance and machine shop and office building. Councilwoman Glick advised Council that two applications for Lot 4, Block 5, were submitted to the Planning Commission simultaneously, however, it was brought to Councilwoman Chick's attention that perhaps Mr. Udelhoven's application may be of more benefit to the City as his proposed building is of considerable higher value than Mr. Diamond's and Mr. Udelhoven states that he would begin construction Immediately. Councilman Ambarian stated that he felt past City policy was to consider the first application submitted and he had been advised that Mr. Diamond's application had been received at City Hall prior to Mr. Udelhoven's. Councilman Whelan stated that if applications are received within the same time frame, the City should favorably consider the most advantageous. With Council concurrence, Mayor Elson asked that both Mr. Udelhoven and Mr. Diamond advise the Council of the intent of their application to lease Lot 4. Mr. Udelhoven - stated that his business would make use of the access to the street for customers as well as the taxiway in the rear. Also, Mr. Udelhoven did state that his application was discussed but not considered by the Planning Commission. j Mr. Diamond - advised that as a present lessee of airport lands, his business was rapidly expanding and there was increasing need for additional space. Also, Mr. Diamond stated that his machine shop and office would require street access as well as availability to the taxiway. N y Councilman Morgan stated that he believed that the Council's obligation is to do what Is in the best interest of the City and at the completion of the Airport Planning Study, additional lands would be available for lease. Therefore, Councilman Morgan stated he would have to vote against the lease to Andy's Flying Service as Mr. Udelhoven's proposed facility would be more beneficial to the City. X _.-- ---- - _--..-�-- - - _... _. _ _ _ T.. ...- - ---- •• �— _ --�.- -----..ems'. KENAI CITY COUNCIL, REGULAR MEETING, MARCH 16, 1977 Page 12 Councilman Ambarian stated that as Andy's Flying Service was currently leasing land from the City and has been doing so for many years and consequently the City should feel some obligation to assist in the expansion of this individual's businesses. MOTION: Councilman Ambarian moved, seconded by Councilman Ackerly, for approval of lease of Lot 4, Block 5, General Aviation Apron, for a term of 55 years at an annual rental rate of $1,166.50 to Andy's Flying Service. Motion failed by roll call vote. Voting no; Whelan, Morgan, Glick and Flson. Voting yes; Ackerly and Ambarian. G-18: Payment Estimate #5 - Interstate Company MOTION: Councilman Morgan moved, seconded by Councilwoman Glick, for approval of Periodic Estimate No, 5, Interstate Company, Inc. in the amount of $24,885 for EDA Water Project No. 07-01-01684. Motion passed unanimously by roll call vote. G-19: Periodic Estimate No. 6 - Brown Construction Company MOTION: Councilwoman Glick moved, seconded by Councilman Whelan, for approval of Periodic Estimate No, 6, to Brown Construction Co., Inc. in the amount of $50,130.41 for EDA Water Project No, 07-01-01684. Motion passed unanimously by roil call vote. H. REPORTS H-1: City Manager's Report (a) Sealand Lease -- payment in full was received by the City of Kenai this date for assessments owing the City on leased land. (b) Structure adjacent to Old Library Building -- will have a proposal at the next meeting regarding removal of the structure attached to the laid Library Building. (c) Ad hoc Committee - Mr. Wise requested an Ad hoc committee to negotiate with interested parties for lease of the airport cafe and bar. Mayor Elson appointed Councilmen Ambarian, Whelan and Ackerly. KENAI CITY COUNCIL, REGULAR MEETING, MARCH 16, 1977 Page 13 MAYOR & COUNCIL - QUESTIONS AND COMMENTS Councilman Whelan inquired as to the status of the Kenai Baptist Temple and was i advised by City Attorney Williams that the appeal was proceeding but due to the �! Court system, the matter was progressing very slowly. Councilman Morgan stated he felt that the City may be open to criticism if the City did not goo to bid on the removal of the structure attached to the Old Library Building. Mr. Wise advised that Administration was just initially exploring the feasibility and estimated costs, etc. Council directed Administration to advertise in a local newspaper _! also. i i ! Councilman Ambarian stated that a boat had been parked at the City dock for some time and requested that Administration investigate the matter and contact the owner to have it removed. I Councilman Ackerly suggested a lease application procedure be established by the City. Mr. Wise stated that an amendment could be made to the lease of City owned lands ordinance could be made establishing lease application procedures. Council unanimously requested the lease application procedure be included on a future work session agenda. H-2: City Attorney's Report None H-3: Mayor's Report ` (a) Mayor Elson advised that he would be travelling to Juneau on Thursday and would be meeting with local legislators, etc. j (b) Mayor Elson also advised that it was necessary for the City to send out letters to E audit firms requesting proposals for the up -coming annual audit. The following firms were selected: Peat, Marwick, Mitchell & Co., Arthur Young, Price -Waterhouse j and Coopers & Lybrand. H-4: City Clerk's Report Clerk Sue Peter requested Council take action on the land sale held prior to the meeting and ratify same by resolution . MOTION: Councilman Morgan moved, seconded by Councilman Whelan, for adoption of Resolution No. 77-38 confirming the sale of Lot 31, Section 6, T5N, R11W, SM, to Glen J. Kipp/Kenai Electric for the price of $8,100.00. t Motion passed unanimously by roll call vote. 0 ?. KENAI CITY COUNCIL, REGULAR MRETING, MARCH 16, 1977 Page 14 MOTION: F Councilman Morgan moved, seconded by Councilman Whelan, for adoption of j' Resolution No. 77-39 confirming the sale of iat 21, Block 2, Black -Gold Estates to Panoramic Incorporated (Mr. William Schweitzer) for the price of $5,000.00. t: l; Motion passed unanimous) b roll call vote. {; p Y Y MOTION: Councilman Ackelry moved, seconded by Councilman Ambarian, for adoption of Resolution No. 77-40 confirming the sale of Lots 6-19, 35-40, Block 10, C. F. Ahlstrom Subdivision to John W. Platt for the price of $15,100. Motion passed unanimously by roll call vote. MOTION: Councilman Ambarian moved, seconded by Councilwoman Glick, for adoption of Resolution No. 77-41 confirming the sale of Lot 13, Block 16, Original Townsite of Kenai to the American Legion for the price of $9,200. Motion passed unanimously by roll call vote. MOTION: Councilman Ambarian moved, seconded by Councilwoman Click, for adoption of Resolution No. 77-42 confirming the sale of Lot 126, Section 31, TON, R11W, SM to Aaron S. Sarks for the price of $9,400. Motion passed unanimously by roll call vote. MOTION: Councilman Whelan moved, seconded by Councilman Ackerly, for adoption of Resolution No. 77-43 confirming the sale of Lot 1, Block 4, Highland Subdivision, to Panoramic Incorporated for the price of $1,900. Motion passed unanimously by roll call vote. MOTION: Councilman Ackerly moved seconded by Councilwoman Glick, for adoption of Resolution No. 77-44 confirming the sale of Lot 30, North of Kenai Road, Section 33, T6N , R11W , SRI to Edwin R. Lowry for the price of $1,520. Motion passed unanimously by roll call vote. R KENAI CITY COUNCIL, REGULAR Mr-.rTING. MARCH 16, 1977 T' Page 15 H-5: Finance Director's Report Finance Director Ross Kinney advised that he had been asked to attend a Chamber of Commerce luncheon and sit on a panel with regard to sales tax -- Mr. Kinney stated his comments would reflect his own thoughts but would also advise what the City has done thus far. Mr. Kinney also reported that the City received $259.000 in sales ' taxes in the first quarter of the year. The finance department has been taking strict action on the accounts receivables and are demanding payments or cutting off service. Councilmen Whelan and Ackerly commended the finance department on its early submittal of the financial statements. H-6: Planning & Zoning Commission's Report Councilwoman Glick reported that the Kenai Advisory Commission held a public hearing on PZ Resolution No. 77-3. Also, the Commission reviewed a lease application for Cook Inlet Industrial Air Park which was tabled as the Commission felt the particular lot in question was not being put to its best use. The Commission also reviewed a subdivision preliminary plat. H-7: Kenai Peninsula Borough Assembly's Report Mayor Elson reported briefly on the Assembly's meeting of March 15, 1977. QUESTIONS: City Manager Wise asked Council concurrence for write the Borough to find out why Nikiski received CETA funds and why the City of Kenai is not eligible to receive funding. Council so concurred. I. PERSONS PRESENT NOT SCHEDULED TO BE HEARD I-1: Mrs. Ruby Coyle Mrs. Coyle inquired as to the process of getting an opinion from the Attorney General as to how Title 29 applies to Home Pule Cities. Mayor Elson advised that this request would have to be made through a State agency or a Legislator. There being no further business to be brought before the Council of the City of Kenai, Mayor Elson adjourned the meeting at 12: 00 midnight. Respectfully submitted, C� o (1) /Sue C . Peter, City Clerk A '10: Mayor Janes Elson and City Cuw-icil '11IRQUGH; Mr. Jain Wise, City Lager FM4: Randall E. Curdle SUBJECT: City Limit Residency Raquirenr-.nts Sirs: I have recently moved my family outside of the Kenai City Limits. This action was prompted by the housing shortage in the City. Being very aware of the present ordinance on euployee requirements, I would like to express my respect for the ordinance, but explain that my choice was through necessity and not desire. I have been living with my family, in Kenai, for the past two years and during that entire time we have looked for a hone to buy, but due to cost and availability of housing, we were unable to find a home that we could afford. I have three children and my wife does not work therefore we are unable to buy a home inside the City on a $19,000 gross annual income. We intend to continue looking for housing inside the City, but our landlord sold the trailer we were living in which ].eft us no choice but to move. unable to find housing in the City we moved onto property that we own on Kalifonski Beach Road. If Council decides to leave the ordinance as is it would cause extreme hardship on my family, thereby burdening me and possibly effecting my ability to perform my duties as thoroughly and competently as I would wish. Your consideration, of the strain and pressure the present ordinance puts on my family, and other loyal and competent city employees and their families, and the time and effort put into solving this dilemma is greatly appreciated. nda11 F. Curdle i I TIMOTHY J ROGERS City of Kenai Box 580 Kenai, AK 99611 ROGERS & BALDWIN ATTORNEYS AT LAW POST Orrice f1OK 1761 KENAI,ALASKA 99611 ULCPNORC (907 203.7167 March 22, 1977 ATTEN: John Wise, City Manager Dear Mr. Wise: C R. BALDWIN Re: Terminal Lease with Brian Peck This will confirm my conversation with you of March 17, 1977. Mr. Peck is willing to negotiate with the City of Kenai concerning the terms under which he would be able to continue in the occupancy of his present quarters at the Airport Terminal Building. It is his position, however, that the eighty-seven cents 0.87) per square foot which was arbitrarily set by council, make continued occupancy economically unfeasible for him or for any succeeding lessee. It is his understanding that a study is in progress which will hopefully result in the establishment of realistic lease rates for the property. It would work to the benefit of the City of Kenai, as well as to Mr. Peck, if Mr. Peck were able to continue as lessee until the study is made final and realistic lease rates are proposed. He stands ready to enter into any negotiations with the City which would further that interest. In the event the posture of the City remains unchanged, Mr. Peck requests that you consider allowing him to remain under the present terms until a new lessee is designated. Such an arrangement would benefit the City and the general public by allowing a continuity of services. Assuming that no lessee is found until after May 1, this arrangement would avoid the economic waste necessitated by the removal of Mr. Peck's equipment and a subsequent installation of equipment by the succeeding lessee. There is no doubt but that it would work to the economic advantage of a succeeding lessee to purchase Mr. Peck's equipment from him, rather than expending the funds necessary to install new equipment in the cafe or bar. v City of Kenai March 22, 1977 'i Page 2 `i Although it was not discussed, at our meeting, I advise you, ;i on behalf of Mr. Peck. that in the event any lessee is afforded more favorable terms than are presently being offered to Mr. Peck, he will feel that he is being discriminated against by the City and act accordingly. Thank you for your consideration of this matter. I i Very trul o s, i I R. Baldwin Attorney at Law CAB: ht =I l -------_ oma. ��.����,n,iiii�:.I SII. ii+�_:.--_�� ._�� '�'..��--_.• VIII�I 11IfII VIII I _JJ..d....11l s. s b OF p Q D /A/ I NAMMONA 6OWN80 S DEPART. NT OF REVENUE Rollout 6L NSE 66N1B6L Som4m W. 1RD AVE, � ANBNomu6 a s 5o l i i :j ! I i March 15, 1977 Mr. John E. Wise City Manager City of Kenai P. 0. Box 580 Kenai, Alaska 99611 Re: Oaken Keg #54 1977 Renewal Application Dear Cdr. Wise: Please be advised that the matter of the City of Kenai's protest of the above renewal will be before the Aicoholic Beverage Control Board !March 23. I will be in contact with you following that meeting regarding appropri- ate procedures. Thank you for your consideration. Very truly yours, ,�°.�..- Linda E. Broom Director LEB:vk 0 It CITY OF KENAI ORDINANCE NO. 333-77 AN ORDINANCE OF THE COUNCIL OF THE CITY OF KENAI, ALASKA, PROVIDING FOR A SPECIAL EXCEPTION TO ORDINANCE NO. 314-76 RELATING TO SPECIAL DEFERRED ASSESSMENTS, WATER AND SEWER. WHEREAS, the Parsons Homestead on Redoubt Boulevard, City of Kenai, fronts some 2,110 feet on a water and sewer line provided by improvement assessment district, and WHEREAS, certain representations were made to the Parsons family by the City administration at the time of forming and levying such assessments, and WHEREAS, in the interest of equity, certain adjustments are required. NOW, THEREFORE, BE IT ORDAINED BY THE COUNCIL OF THE CITY OF KENAI, ALASKA, as follows: Section 1: Deferred assessments on Sewer District S-2, Resolution No. 76-82, Identification Numbers 207 and 208 in the amounts of $8,974 and $9,153.00 respectively and Water District W-1, Resolution No. 76-81, Identification Numbers 332 and 333 in the amounts of $8,974.60 and $9,153.00 respectively, Parsons Homestead, be exempt from provisions of those resolutions relative to deferred assessments and Ordinance No. 314-76 of the City of Kenai to the extent that the above listed deferred assessment be exempt from interest and/or penalty until any part of the homestead as it exists as of January 1, 1977 is subdivided or title or control is transferred to other than Hedley and/or Ruth Parsons, owners of record as of January 1, 1977. Section 2: Those assessments not deferred, $3,341.25 for each water Improvement and sewer improvement, may be paid in full without penalty or Interest if such payment is made prior to A1ay 20, 1977. �dZCr!'J.11!r)1111 IIII 11,11.E i� ORDINANCE NO. 333-77, Page Two r Section 3: As per existing policy, water and sewer connections may be made at the property owners expense upon payment only of existing water and sewer tap fees. PASSED BY THE COUNCIL OF THE CITY OF KENAI, ALASKA, this day of April, 1977. ATTEST: Sue C. Peter, City Clerk 1 R It JAMES A. ELSON , MAYOR FIRST READING: SECOND READING: EFFECTIVE DATE: I t ,_-"I CITY OF KENAI, ALASKA MEMORANDUM TO: Honorable Mayor & City Council FROM: .Tanis C. Williams, City Attorney DATE: March 11, 1977 SUBJECT: PARSONS ASSESSAVNTS The Parsons have requested that they be allowed an extension of time to pay their regular assessment without interest or penalty and that they, in effect, be exempted from the provisions of Ordinance 314-76 regarding special deferred assessments which was passed by the Council in October of 1976. I have discussed this question with the Finance Director and he has asked whether it would be legal to take such actions in light of the constitutional equal protection guarantee. Equal protection in the sense that it applies in this case, requires impartiality as between persons similarly situated. The general rule is that equal protection is denied where a public law applies (in its operation as distinguished from its enforcement) differently to different persons under the same or similar circum- stances. Thus, to decide the question, we must look at the other persons affected as well as the Parsons. With regard to the regular (un -deferred) assessments representing the first 330 feet of frontage, I cannot see that the Parsons are in any different situation than any of the other persons in the 1973 districts. This, however, to a question for determination by the legislative body. To aid you in making your decision, ,you need sufficient data to determine why the Parsons are or are not differently situated. With regard to the special deferred assessments, the Parsons property could possibly be construed to be in a different class from other properties upon which special deferred assessments have been levied because of the very large amount of frontage on the water and sewer lines. It is only where some persons which are excluded from the operation of the ordinance are, as to the particular subject matter, in no differentiable class from those included in its operation that the ordinance can be declared discriminatoryin the sense of being artitra g ry and unconstitutional. In order to determine if the Parsons are in a differentiable class, their property must i! be compared with all other properties which have special deferred assessments levied against them. To make your decision, you need detailed information regarding the other special deferred assessments. It is again a legislative determination. If there is reasonable basis for any classification the Council might choose to make, the courts are unlikely to overturn it. r MEMORANDUM, Page Two Another problem is the mechanics by which the Parsons could be given the proposed exemptions. The extension of time to pay without penalty and the exemption from interest proposed would require a resolution which would in effect amend the reassessment resolutions recently passed. I again would advise you against taking this action only for the Parsons because I cannot see how they are in any different situation from other persons in these districts. It will require an ordinance to treat the Parsons differently from others with regard to special deferred assessments since the treatment of all special deferred assessments was established by Ordinance 314-76. In light of the Parsons situation, the Council might wish to reconsider the policies set forth in Ordinance 314-76. If you are going to hear the Parsons, the only fair way to handle the matter would be to call for a public hearing with notice to all persons with special deferred assess- ments. In this way, you would hear the problems of the other property owners and be in a better position to determine a possible new policy or a basis for differentiation of the Parsons. JCW: sp iuK�.r rN­ ru:mwi iii ii.L II h_. --- L..II_. I I. I •........idHIM MEMORANDUM TO: FROM: DATE: SUBJECT: CITY OF KENAI, ALASKA Honorable Mayor & City Council Ross A. Kinney, Finance Director March 11, 1977 SPECIAL ASSESSMENTS i Mr. and Mrs. Parsons have requested that payment of assessment levied on the first 330 feet of frontage in the amount of $6, 682.50 be paid in a lump sum without interest and penalty if paid within 60 days of Council approval. It should be pointed out that the penalty was forgiven for installments due prior to April 1, 1977 and interest for the period of March 1, 1973 to March 1, 1974 was waived. Council policy to -date has been that 8% interest has and will be charged on the outstanding principal amount to the date of payment. Penalty of 10% will be charged on delinquent installment payments made after April 1, 1977 with the exception of the 1975 and 1976 installments. To allow the Parsons the advantage of not paying the 8% interest from March 1, 1974 to the date of payment, and waiver of the 10% penalty on the 1977 installment payment should it not be paid prior to April 1, 1977 would be an injustice to the other property owners against whose property assessments were levied unless they are also allowed the some privilege. Assessment principal and interest payments received thus far by the City and those to be received in the future on the 1973 districts will not pay the prinieipal and interest on the bonds sold to finance the construction of the various projects. Any reductions in principal, interest, and penalty such as those that have been made and those being considered are simply shifting the burden of payment from those who benefitted to the City as a whole. The monies required to retire the bonded debt remain unchanged. The question of deferred assessments has once again been raised. The Parsons are requesting that $36,255.20 of assessments be deferred until the property in question is subdivided or title transferred from their family. in 'II order to accomplish this, Ordinance No. 314-76 must be rescinded. i The repeal of this ordinance raises the following questions: 1. What sources of funding will be used to retire the bonded Indebted- ness in lieu of these assessments? 2. How does the City intend to apply the money should the property i not be subdivided or title transferred prior to date of final payment on the bonds? RAK: sp CITY OF KENAI ORDINANCE NO. 314-76 AN ORDINANCE OF THE COUNCIL OF THE CITY OF KENAI CLARIFYING THE STATUS OF SPECIAL DEFERRED ASSESSMENTS IN CERTAIN WATER AND SEWER IMPROVEMENT DISTRICTS. WHEREAS, Ordinance 234-73 creating Sewer Improvement District 73-S2, Resolution 74-4 creating Water Improvement District No. 8, Resolution No. 74-5 creating Water Improvement District 73-111, Resolution No. 74-6 creating Water Improvement District 73-W2, Resolution No. 74-9 creating Water Improvement District 13-W5, Resolution 74-10 creating Sewer Improvement District 73-S1 contain a provision reading as follows: So much of parcels of benefitted land with frontage in excess of 330 ft. on this district, held as an unsubdivided parcel, may have payments deferred on assessments until such parcel or parcels are subdivided. WHEREAS, such provisions do not clearly delineate how and when such special deferred payments are to be made, and WHEREAS, it is the intent of the Council to establish a policy with regard to special deferred payments in the above-named districts. NOW, THEREFORE, BE IT ORDAINED by the Council of the City of Kenai, Alaska as follows: Section 1: Section 5 (E) of Resolutions 74-1, 74-5, 74-6, 74-9 and 74-10 and Section 4(1:) of Ordinance 234-73 are and each of them is hereby amended to read in their entirety as follows: E. Parcels of benefitted land in this district with frontage in excess of 330 feet may have that portion of their assessment payments attributable to the excess of 330 feet deferred until such parcel is sold or subdivided. If any payments are deferred, they shall be handled in the following manner: a. The total special deferred assessment shall be set up in installments over the life of the district in the same manner as assessments which have not been deferred. Such schedule of installments is hereinafter referred to as the "installment schedule". The sum of the principal and interest of each payment shall be hereinafter referred to as the "annual installment". The dates upon which payments are due in accordance with the installment schedule are hereinafter referred to as the "schedule due dates" . I f V ORDINANCE NO. 319-7G - Page Two b. No annual installment on special deferred assessments shall be ! due until the parcel is subdivided or title to the parcel is transferred. A parcel shall be deemed subdivided when the subdivision plat is duly recorded ! with the Kenai District Recorder in accordance with statute. The title to a parcel shall be deemed to have been transferred when the instrument evidencing transfer of title is duly recorded with the Kenai District Recorder in accordance with statute. I° C. Upon subdivision of a parcel, all annual installments whose schedule due dates have pased, shall be due and payable with interest at the i rate of 8 percent on the principal portion of each annual installment from its schedule due date to the date payment is made. If payment is not made within 90 days of the date of subdivision, a penalty of 10 percent shall be added to the amount due. Such penalty shall be based on the total of the annual install- ments only and not upon interest on the annual installments. i d. Upon transfer of title to a parcel, annual installments shall be- come due in the some manner as if the parcel were subdivided and interest and penalty shall be computed in the same manner. e. Annual installments remaining after payment is made in accordance ( with subparagraphs c. or d. hereinabove shall be made according to the ! installment schedule in the same manner as assessments which have not been deferred. 11 t.,::) f. In the event special deferred assessments on a parcel have not been paid in accordance with other applicable provisions of law by the last schedule due date in the installment schedule, all annual installments in the installment schedule shall immediately become due and payable with interest at the rate of 8 percent on the prinicipal portion of each annual installment from its schedule due date to the date of payment. if payment is not made within 90 days of the last schedule due date, a penalty of 10 pergent on the total of all the annual installments shall be added to the amount due. .9. Parcels upon which special deferred assessments have become due and payable shall be subject to foreclosure in accordance with statute in the same manner as parcels with assessments which have not been deferred. PASSED BY THE COUNCIL OF THE CITY OF KENAI, ALASKA, this 20th day of October, 1976. ATTEST:- S C. Peter, City Clerk ___Y � a, ( 4, ro'7l/ MAYOR JAMES A. ELSON FIRST READING: October 6, 1976 SECOND READING: October 20, 1976 EFFECTIVE DATE: November 20, 1976 I- 71 71 N v� d Mayor & Council City of Kenai P.O. Box ;30 Kenai, Alaska RE: .later and Sewer Assessments - 8-2 2070209 W-1 Gentlemen: When the City proposed installation of water and setter lines in flomecite Loop abutting our property, we ob- jected. We did not desire public water and sewer at that time and had no intention of subdividing or other- wise developing our homestead. Now we are in receipt of assessments totalling $42,937.70. At t: -is time, ze are not utili&ing public urate or sewer nor do �,-e intend to use it in the foreseeable future. In accordance with tho attached letter, dated June 28, 1972, there was a pledoge by the City that none of the assessments would be due until Item 1 or Item 2 were effected. It also appears that there trould be no interest levied against our properties until, again, either Item 1 or Item 2 became effective. Now we are informed that: 1. The first 330 feet of frontage is not exempt or de- ferred from assessment - $69682.50 plus interest. - ---- ---- -Y- -.-- -r.- - r ----% % - --- - "-7 - - - - f 2. The additional frontage, approximately 1900 fe-A, while deferred, is being charted 8, interest. Further, that this means S36,2'5-20 till grow during the period of deferral, maximum of ten (10) years, to $65,259.40. Yre feel, justifiably, that we have been misled and taken advantage of. We therefore petition the City Council to waive interest during the life of the deferment and further, permit the deferment period to run until our homestead is sub- divided or title transferred from the Parsons family. We agree to acknowled a and make appropriate payment on the first 330 feet of frontes;e totaling 36,682.50 in a lump sum, no interest or penalty if paid within 60 days of council approval; further, that Parsonst house be allowed grater and sewer with no change in deferment, only hook-up fees. i Enclosed is letter from City of Kenai dated June 0, 1972. U�edle,y V. Parson U Muth A. Parsons t a L 4 t 3, F Ne June 28, 1972 Mr. & Mrs. Hedley Parsons Star Route #3 Kenai, Alaska 99611 .t Dear Mr. & Mrs. Parsons: i In regards to your inquiry concerning assessments for za 5 :r projects IIPC-ALA-35 and WPC -AK -10-19-1017, Kenai's sewer interceptor lines and water transmission line projects, wr ��- i i the City haz outlined thc: _ollow- g wssessr..cwt prcv-sions for large undeveloped land holdings: 1. No assessment will be levied against the property until the time of actual "hook up". 2. At that time, assessments will be levied only against the subdivided lot on which the connected dwelling sets. 3. Assessments under this provision shall be treated according to the City's "payment in lieu of assessment provision." 4. Property which falls under this category shall not receive any consideration for having available water and/or sewer facilities until the date of actual hook-up. Such consideration shall cover subdivision rights, fire in- surance adjustment or certificate of adequacy provisions. I hope this clarifies your position in regards to future assessment's. however, should you require future information, please feel free to call this office at any time. Sincerely, nice A. Massey Assistant City Manager _SAM/db: r _ -"% - --111w nir�iwiwi -- � IR.LIIIlIAIIIII X61111 110111111 1 1 . I CITY OF KENAI RESOLUTION NO. 77-29 A RESOLUTION OF THE COUNCIL OF THE CITY OF KENAI, ALASKA, AUTHORIZING REFUNDS TO CERTAIN PROPERTY OWNERS IN THE 1973 ASSESSMENT DISTRICTS. WHEREAS, Resolutions 76-81, 76-82, 76-83, 76-84, 76-85, 76-86, 76-87, Section 4, paragraph C, reads in part as follows: "When there are no future annual installments against which to credit any amount over -paid on the parcel, a refund will be made to the current owner of the parcel as reflected in the Kenai Peninsula Borough Tax Assessment Rolls." WHEREAS, the payments have been reapplied to the installment schedule, and WHEREAS, in certain cases refunds are warranted. NOW, THEREFORE, BE IT RESOLVED by the Council of the City of Kenai, Alaska. as follows: Section 1: Refunds in the amounts as shown on the enclosure attached hereto and incorporated herein by reference are authorized to the named persons. Section 2: In the event any of the attached named persons have delinquent account receivable balances for any purpose according to City records, then these delinquent amounts shall first be subtracted from the amount set forth in the enclosure attached before refund is made to such persons. PASSED BY THE COUNCIL OF THE CITY OF KENAI, ALASKA, this 16th day of March, 1977. ATTEST: Sue C. Peter, City Clerk JAMES A. ELSON, MAYOR LE IS.;, wol am% •00% 244 P,# SATO, ovq�- 010 - 3 In o rK $0, %161 too KS—: or$ slat 7 7 7 for.. 31 "W.. 41 .1 O..,At. I A L IV 74. I eelf: 11 11 §7 MISS. off'! P. A to• If 'es.. lift e*p4 "9.A;1 Ole 01/ fee*.V., J? -t" -e!le Ito) : I -icy ---A qd& , 0114oft Mm- /foe, —to Ir 79 94 (.1 jj Pit fad.. So -4 ,4 t4 F4, Is "Oa- Irdy 1`00 Is IS at i2w), L f%, ) r It IS to ve r1GA JPI$ 41. Vat go•lot tr,a"b 'a le"Is - tr -C ..};I yf{.?1e;�6ea, Itl 8^l , I I! .7./t1: ;� :! I :.b6►>>s :~ .; _* _ 6.6 Ow Sol 00 LJ Rot 4 -*.1 ��.?%•C2/�'.::Gw01 It Beta t L —..IV a-kl 66# 53 5, Kc -411. x I , - I I T I 45 Ll Too -.1 r4j- Ti IT L - - T, ­ - —r « -4 --- , — —I,— — --,Mpow- I I log op— is 'r J ej V14: I 411 . 0 F'O I SO I - hod', .4 —4— ilwa- COO. 04 I 44 • C -V1 T -1- IT. It» , ..,-._... _} -r, ... ..� �. 4 , �:,�_ � '.1111}.. .. :y�; .�fi ii. i�.-: i. .� � :a. .. .t ..l..�....fr Jl� I El — ­.- . - — - n -._• ' i. _ . ___,.___ _ _._._._ -•. - - it CITY OF KENAI ORDINANCE NO. 334-77 AN ORDINANCE OF THE COUNCIL OF THK CITY OF KENAI, ALASKA, PROVIDING THAT THE QUESTION OF DEDICATING CERTAIN BOND FUNDS TO THE CONSTRUCTION OF WATER AND SEWER IMPROVEMENTS BE SUBMITTED TO THE QUALIFIED VOTERS OF THE CITY OF KENAI. WHEREAS, to further the health and welfare of the inhabitants of the City of Kenai, Alaska, it is deemed necessary and advisable that the City transfer $334,583 of the remaining proceeds of the 1974 Advance Refunded General Obligation Bonds of the City of Kenai to Water and Sewer System Improvements for the purpose of providing part or all of the funds necessary to plan, acquire, construct, and install major capital improvements to the water supply and distribution system and the sanitary sewer system of the City. NOW, THEREFORE, BE IT ORDAINED by the Council of the City of Kenai, Alaska, as follows: Section 1: It is hereby found and declared that the public health, welfare, safety, and convenience require the City of Kenai to carry out plans for major capital improvements to the water supply and distribution system and the sanitary sewer system of the City by the reallocation of $334,583 of the remaining proceeds of the 1974 Advance Refunded General Obligation Bonds herein described for such purposes. Section 2: The City shall design, plan, acquire, construct and equip the following capital improvements: A. Major improvements to the water supply and distribution system such as major transmission lines, a fire reservoir, and Improve- ments to the water well. B. Major improvements to the sanitary sewer system to include such items as treatment plant expansion, additional lift stations and improvements. Section 3: In the event that the funds available for any of the above projects will not permit the acquisition, construction, and installation of all the improvements for which this transfer is approved, such portion of the improvements as may be found most necessary by the Council of the City of Kenai, Alaska, shall be acquired, constructed and installed. LE I s s. ' i. _ . ___,.___ _ _._._._ -•. - - it CITY OF KENAI ORDINANCE NO. 334-77 AN ORDINANCE OF THE COUNCIL OF THK CITY OF KENAI, ALASKA, PROVIDING THAT THE QUESTION OF DEDICATING CERTAIN BOND FUNDS TO THE CONSTRUCTION OF WATER AND SEWER IMPROVEMENTS BE SUBMITTED TO THE QUALIFIED VOTERS OF THE CITY OF KENAI. WHEREAS, to further the health and welfare of the inhabitants of the City of Kenai, Alaska, it is deemed necessary and advisable that the City transfer $334,583 of the remaining proceeds of the 1974 Advance Refunded General Obligation Bonds of the City of Kenai to Water and Sewer System Improvements for the purpose of providing part or all of the funds necessary to plan, acquire, construct, and install major capital improvements to the water supply and distribution system and the sanitary sewer system of the City. NOW, THEREFORE, BE IT ORDAINED by the Council of the City of Kenai, Alaska, as follows: Section 1: It is hereby found and declared that the public health, welfare, safety, and convenience require the City of Kenai to carry out plans for major capital improvements to the water supply and distribution system and the sanitary sewer system of the City by the reallocation of $334,583 of the remaining proceeds of the 1974 Advance Refunded General Obligation Bonds herein described for such purposes. Section 2: The City shall design, plan, acquire, construct and equip the following capital improvements: A. Major improvements to the water supply and distribution system such as major transmission lines, a fire reservoir, and Improve- ments to the water well. B. Major improvements to the sanitary sewer system to include such items as treatment plant expansion, additional lift stations and improvements. Section 3: In the event that the funds available for any of the above projects will not permit the acquisition, construction, and installation of all the improvements for which this transfer is approved, such portion of the improvements as may be found most necessary by the Council of the City of Kenai, Alaska, shall be acquired, constructed and installed. LE I s — -� •rte -�-- ._•- - s. �� -� �.-- - � — �_.��all ORDINANCE. NO. 334-77, Page Two Section 4: Propositions of whether or not the City shall transfer $334,583 of the remaining proceeds of the 1974 Advanced Refunded General Obligation Bond Issue for the purposes described in Section 2 hereof shall be submitted to the qualified voters of the City of Kenai for their ratification or refection at the general election to be held within the. City on the 11th day E of October, 1977. Said proposition shall be in the following form: PROPOSITION Water & Sewer System Improvements $334,583 Shall the City of Kenai, Alaska, transfer $334,583 from the proceeds of the 1974 Advance Refunded General Obligation Bond dedicated to the Civic Center Complex to Water and Sewer System Improvements, for the purpose of providing part or all of the funds necessary to plan, acquire, construct and install capital improvements to the water supply and distribution system and the sanitary sewor system of the City? YES I NO PASSED by the Council of the City of Kenai, Alaska this 20th day of April, 1977. JAMES A. ELSON, MAYOR ATTEST: Sue C. Peter, City Clerk FIRST READING: SECOND READING: EFFECTIVE DATE: CITY OF KENAI ORDINANCE NO. 335-77 AN ORDINANCE OF THE COUNCIL OF THF. CITY OF KENAI AUTHORIZING A LAND SALE OF TAX AND ASSESSMENT FORECLOSURE PROPERTIES WHEREAS, certain lands have been foreclosed on by the Kenai Peninsula Borough for nonpayment of real property taxes and have been deeded by the Superior Court to the City of Kenai, and WHEREAS, certain lands have been foreclosed on by the City of Kenai for nonpayment of special assessments and have been deeded by the Superior Court to the City of Kenai, and WHEREAS, the City has no public use for the parcels listed in this ordinance and to empowered by State Statute to sell such parcels. i NOW, THEREFORE, BE IT ORDAINED by the Council of the City of Kenai, Alaska, as follows: Section 1: The following parcels foreclosed on by the Kenai Peninsula Borough shall be offered for sale by the City of Kenai as provided in Section 4 hereof. The minimum bid shall be as stated opposite each parcel. The Buyer shall be liable for payment to the City of those special assessments listed: �J M1rTIM".. SPFCIAL DESCRIPTION BIT) ASSPSSPIENTS nUP Lots 1, 2, 15, 16, Block 11, C. F. Ahlstrom $5,000 Subdivision (Tax Parcels #039-054-0100, 0200, 1500, 1600) Lot 15 Lot 16 Lot 43, Section 31, T6N, R11W, SM $4,500 (Buyer must dedicate 30' ROW for road) (Tax Parcel #043-090-0800) Section 4, TSN, RIM SM $4,500 190' E of NW Corner of Sec. 4; Th E 2081; Th S 2481; Th W 2081; Th N 2481; to POB Cntg. 1.00 acres M/L f r t I. 1' ii i $91.90 due each April lot - 1977 - 1984 $98.03 due each April lot - 1977 -1984 One payment of $332.05 due December 1, 1977 One payment of $722.97 due December 1, 1977 IL 1.1 I .A .I AN ORDINANCE OF THE COUNCIL OF THF. CITY OF KENAI AUTHORIZING A LAND SALE OF TAX AND ASSESSMENT FORECLOSURE PROPERTIES WHEREAS, certain lands have been foreclosed on by the Kenai Peninsula Borough for nonpayment of real property taxes and have been deeded by the Superior Court to the City of Kenai, and WHEREAS, certain lands have been foreclosed on by the City of Kenai for nonpayment of special assessments and have been deeded by the Superior Court to the City of Kenai, and WHEREAS, the City has no public use for the parcels listed in this ordinance and to empowered by State Statute to sell such parcels. i NOW, THEREFORE, BE IT ORDAINED by the Council of the City of Kenai, Alaska, as follows: Section 1: The following parcels foreclosed on by the Kenai Peninsula Borough shall be offered for sale by the City of Kenai as provided in Section 4 hereof. The minimum bid shall be as stated opposite each parcel. The Buyer shall be liable for payment to the City of those special assessments listed: �J M1rTIM".. SPFCIAL DESCRIPTION BIT) ASSPSSPIENTS nUP Lots 1, 2, 15, 16, Block 11, C. F. Ahlstrom $5,000 Subdivision (Tax Parcels #039-054-0100, 0200, 1500, 1600) Lot 15 Lot 16 Lot 43, Section 31, T6N, R11W, SM $4,500 (Buyer must dedicate 30' ROW for road) (Tax Parcel #043-090-0800) Section 4, TSN, RIM SM $4,500 190' E of NW Corner of Sec. 4; Th E 2081; Th S 2481; Th W 2081; Th N 2481; to POB Cntg. 1.00 acres M/L f r t I. 1' ii i $91.90 due each April lot - 1977 - 1984 $98.03 due each April lot - 1977 -1984 One payment of $332.05 due December 1, 1977 One payment of $722.97 due December 1, 1977 IL . ORDINANCE NO. 335-77, Page Two Section 2: The following parcels foreclosed on by the City of Kenai shall be offered for sale in accordance with Section 4 hereof. The minimum bid shall be as stated opposite each parcel. The Buyer shall be liable for payment to the Borough of those delinquent real property taxes listed: MINtn�ilM SPECIAL DESCRIPTION Rin ASSERMIFNTS T)UP Lot 5, Block 3, East Addition to $2,000 Kenai Townsite, Kenai Recording Dist. (Tax Parcel #047-113-0200) B 1/2 Gov't. Lot 36, See. 31, T6N,P.IIW,SM $6,000 (Tax Parcel #043-050-1200) Section 3: The following parcel has been foreclosed on for nonpayment of taxes and special assessments. The Council hereby finds that because of the size, topography and general location of this parcel, it is not suitable for any conventional private land use and that it should be restricted to non-structural use unless combined with surrounding lands. Its market value accordingly for less than it would be under normal circumstances. The minimum acceptable bid is therefore as stated opposite the parcel. Buyer will be liable for payment of that special assessment listed: Lot 11, Block 2, East Addition to Kenai $ 75 One payment of 9;R3.95 Townsite, Kenai Recording Dist. due December 1, 1977 (Tax Parcel #047-112-0600) (No structure or other improvement may be placed on this parcel unless combined with surrounding lands.) A /11 Section 4: The properties listed in Section 120' d 2 shall be offered for sale at a public outcry auction to be held on June 15, 1977 at . 00 p.m. at the Kenai Public Safety Building, corner of Willow Street and Main Street Loop, Kenai, Alaska. Section 5: Notice of such sale shall be given in accordance with City ordinance and in addition a Notice of Sale shall be mailed to the last record owner of each of the parcels offered for sale. Such notices shall state that the parcels offered for sale may be redeemed by the record owner at any time prior to their actual sale. Notice shall also state that the City makes no representations or warranties as to its right. title or interest in the properties and that conveyance shall be by tax foreclosure quitclaim deed. V- ---.4 - •�+���� -�- -�-,� I IIII LII LIII I I � I I III ORDINANCE NO. 335-77, Page Three a Section 6: The highest responsible bidder at the time of sale shall deposit 1090 of the bid or $1, 000,' whichever is greater, as earnest money and shall pay the remaining balance at the time of closing. Closing shall be within ninety (90) days of the date of sale. Costs of closing shall be paid by the Buyer. For bids in excess of $5,000. Buyer, at his option may deposit 20% of the bid and execute an agreement for payment of the remaining balance in ten equal annual installments plus interest at the rate of 8% with title to be trans- ferred to Buyer only upon payment of all installments. All property is sold subject to plat, covenant, zoning restrictions and special assessments. City is not liable for payment of any brokerage fees in connection with this sale. PASSED BY THE COUNCIL OF THE CITY OF KENAI, ALASKA, this 20th day of April, 1977. ATTEST: Sue C. Peter, City Clerk JAMES A. ELSON, MAYOR FIRST READING: SECOND READING: EFFECTIVE DATE: 1 -v I tv 86 64 1- ..83 ir 89- • Its (2-2 ij 41 ip U7 /Jo 2 7eV I l , POR. SEC. S. T5N, RIIW, SB.&M 47-11 t 43 � . - �r. wa• ± ---- /!I A1 M16wW5 / 1 _ � Ii6N1q OPVR f, A. . � iw t t Atr (6 '9�0'• O� 1 •O J 111 to � • { `/ y n� oto ,t _Lt 1 012 ty " � e 7 Q 0 ® , ©. N t7 10 e t� qU.K. 1,2 M O MARINE - wT "• `i' '4- .A� v, t •J 1� ► :171' OR KQNAI .� "` f t •O © � w •r I BLK. 8 ®O ®� 114 th " ,si w Y ,i 2 0 9t t/ „ , ` ,s. ,13 r 5 1 t 141. 1. �5 .4 ., ,off ; 9 t •� �t O. It lil j (O 1 6L� 41 Ml,i AVE , ru r 0Al ® $ 117 O LK. 7 L;°:;;KE JA1 TOVN; SBI�t.TE.K• —�SEA=S eTd_ ADDiT10N. •,w• /•e•" an. sits Kenai Peninsula Borough, Alaska NOTL– Au•uuo etewt Nombut ens.• U [160.1. Au...«: Past IW,mt,/. Oftn* IA Wfl,t f17- 113- S •1't) OZOV I ± POR. SEC. S. T5N, RIIW, SB.&M 47-11 t 43 � . - �r. wa• ± ---- /!I A1 M16wW5 / 1 _ � Ii6N1q OPVR f, A. . � iw t t Atr (6 '9�0'• O� 1 •O J 111 to � • { `/ y n� oto ,t _Lt 1 012 ty " � e 7 Q 0 ® , ©. N t7 10 e t� qU.K. 1,2 M O MARINE - wT "• `i' '4- .A� v, t •J 1� ► :171' OR KQNAI .� "` f t •O © � w •r I BLK. 8 ®O ®� 114 th " ,si w Y ,i 2 0 9t t/ „ , ` ,s. ,13 r 5 1 t 141. 1. �5 .4 ., ,off ; 9 t •� �t O. It lil j (O 1 6L� 41 Ml,i AVE , ru r 0Al ® $ 117 O LK. 7 L;°:;;KE JA1 TOVN; SBI�t.TE.K• —�SEA=S eTd_ ADDiT10N. •,w• /•e•" an. sits Kenai Peninsula Borough, Alaska NOTL– Au•uuo etewt Nombut ens.• U [160.1. Au...«: Past IW,mt,/. Oftn* IA Wfl,t f17- 113- S •1't) OZOV I CITY OF KENAI RESOLUTION NO. 77-45 ''D BY THE COUNCIL OF THE CITY OF KENAI, ALASKA, THAT 'G TRANSFER OF MONIES BE MADE WITHIN THE 1976-77 4UE FUND BUDGET. itizens Nutrition Program rofessional Services $2,700.00 The purpose of this resolution is to transfer funds within the Nutrition Department for the purchase of a commercial refrigerator ($1,310), a meal warmer "hot box" ($240) . commercial deep pot sinks ($620), and for the construction of a pantry close to the kitchen at Fort Kenay ($630) for the purpose of storing case goods and � t other foods and related paper products for the operation of the Nutrition Program. 1 I PASSED BY THE COUNCIL OF THE CITY OF KENAI, ALASKA, this 6th day of April, 1977. i JAMES A. ELSON, MAYOR. ATTEST: Sue C. Peter, City Clerk ! t M n 1 f + r ' a I �I ;I �I 'I BE 1 THE 'I SPE+ ,I PRO i i I Tn. CITY OF KENAI RESOLUTION NO. 77-45 ''D BY THE COUNCIL OF THE CITY OF KENAI, ALASKA, THAT 'G TRANSFER OF MONIES BE MADE WITHIN THE 1976-77 4UE FUND BUDGET. itizens Nutrition Program rofessional Services $2,700.00 The purpose of this resolution is to transfer funds within the Nutrition Department for the purchase of a commercial refrigerator ($1,310), a meal warmer "hot box" ($240) . commercial deep pot sinks ($620), and for the construction of a pantry close to the kitchen at Fort Kenay ($630) for the purpose of storing case goods and � t other foods and related paper products for the operation of the Nutrition Program. 1 I PASSED BY THE COUNCIL OF THE CITY OF KENAI, ALASKA, this 6th day of April, 1977. i JAMES A. ELSON, MAYOR. ATTEST: Sue C. Peter, City Clerk ! t M n 1 f + r ' a I �I 11114S . .. ._ ' _ __ _� __- __ _ .� -_ ._z - -..-,.36--""= Y'- tA.--�" •- � . �II I I I II 1 II I I I IIIIII�� Capt. David Clitheroe Salvation Army Senior Center 135 B. 8th Ave. Anchouage, Ak. Dear Capt. Clitheroe, t - March 11, 1977 I have enclosed a copy of the schedule showing the requested line item changes in our 1176-77 Budget for the Nutrition Program. The reason for the reclassification from Personnel to Professional Services is because we have contracted out the Site tlanager, Cook;* and Driver. The reason for the increase in Equipment is to purchase the following much-needed iters: Commercial refrigerator (46 cu.ft.) $ 1,310 Commercial "pot" sinks 520 Meal warmer "hot box" 240 Construction of pantry near kitchen 630 $ 2,%00 For your information I have enclosed a copy of our projected budget for SIX months of operation. l'e are holding pretty steady between 2S to 30 teals per day. 11hen we begin meal delivery it will boost it to nearly 23 to 33 meals per day. It looks as though we will very nearly require the full amount of the Grant Award oven though that award was based on a year's operation. Our revised Projection of cost per meal is very nuch in line with the cost of 'eating out" here in the Kenai area, so the overall Budget still appears to be reasonable. iso had estimated that over a year we would collect $1,500 in project income. lie are pleased to report that our income has averaged about $65 per week which will easily earn $1,500 of project income in six months of operation. I have also enclosed a statistical report from when we began through Feb. When we were all at the Workshop both Capt. Gaines and Grace Billings gave verbal approval for the line itom transfer to Equip- ment. Our City Council is requiring written authorization before they will allow me to order. As soon as Juneau approves. the changes could you please notify us in writing. Approve for mailing: John Wise, City Manager Very truly yours, Susan Cartwright, Accountant If 1 ! III I I II1 111- III a! `4 CITY OF KENAI RESOLUTION NO. 77-46 BE IT RESOLVED BY THE COUNCIL OF THE CITY OF KENAI , ALASKA, THAT THE FOLLOWING TRANSFER OF MONIES BE MADE WITHIN THE 1976-77 GENERAL FUND BUDGET. FROM: Communications - Salaries & Wages ($2,000) TO: Legislative Advertising $ 500 Printing & Binding 500 Professional Services 11000 The purpose of this resolution is to transfer funds within the 1976-77 General Fund Budget in order to fund the Special Flection to be held May 17, 1977, per Ordinance No. 328-77. PASSED by the Council of the City of Kenai, Alaska, this 6th day of April, 1977. JAMES A. ELSON , MAYOR ATTEST: Sue C. Peter, City Clerk ' CITY OF KENAI RESOLUTION NO. 77-47 T- r i A RESOLUTION OF THE COUNCIL OF THE CITY OF KENAI, ALASKA, RATIFYING i THE TELEPHONE POLL FOR THE PURCHASE AND INSTALLATION OF A WATER PUMP IN CONNECTION WITH KENAI WATER PROJECT NO. 07-01-01684. 3, WHEREAS, the water well project has had an adverse effect on the water supply of property adjacent to the well site, and WHEREAS, the purchase and installation of a water pump was considered to be the most advantageous solution to this problem, and WHEREAS, EDA has disallowed this expenditure under the terms of the grant, and WHEREAS, the pump was not budgeted in the 1976-77 Water & Sewer Budget, and WHEREAS, the City Clerk conducted a telephone survey of the Council approving the purchase. -J NOW, THEREFORE, BE IT RESOLVED by the Council of the City of Kenai, Alaska, that the telephone poll of the Council taken A7areh 18, 1977 approving the purchase and installation of a water ARUMpin the Aknount of $476 be ra ified d exna seMd in ` t e Water & Sewer Fund. �'" q 24k MA L PASSED by the Council of the City of Kenai, Alaska, this 6th day of April, 1977. JAMES A. ELSON , MAYOR ATTEST: Sue C. Peter, City Clerk a l _ _ ! i; s' CITY OF KENAI a RESOLUTION NO. 77-98 A RESOLUTION OF THE COUNCIL OF THE CITY OF KENAI, ALASKA, RATIFYING THE TELEPHONE POLL FOR THE PAYMENT OF $5,000 TO HUTCHINGS SALES & SERVICE FOR A POLICE PATROL CAR. _. WHEREAS, Resolution No. 76-67 authorized the purchase of a 1977 Chevrolet Nova, and WHEREAS, the vendor requested payment prior to the next regularly scheduled Council meeting, and WHEREAS, the City Clerk conducted a telephone survey of the Council approving the payment. NOW, THEREFORE, BE IT RESOLVED by the Council of the City of Kenai, Alaska, that the telephone poll of the Council taken March 18, 1977 approving the payment of $5, 000 to Hutchings Sales & Service for the 1977 Police Patrol Car be ratified. PASSED by the Council of the City of Kenai, Alaska, this 6th day of April, 1977. JAMES A. ELSON , MAYOR ATTEST: Sue C. Peter, City Clerk MILL a LL".. I..._ ? CITY OF KENAI ' RESOLUTION NO. 77-50 BE IT RESOLVED BY THE COUNCIL OF THE CITY OF KENAI, ALASKA, THAT # THE FOLLOWING TRANSFER OF MONIES BE MADE WITHIN THE 1976-77 AIRPnRT TERMINAL MANAGER BUDGET. FROM: Airport Terminal Manager - Professional Services ($800) TO: Airport Terminal Manager - Repair a Maintenance Supplies $800 The purpose of this resolution is to transfer funds within the Airport Terminal Manager Budget for the purchase of paint and supplies to be used to paint a mural on the terminal building. PASSED by the Council of the City of Kenai, Alaska this 0th day of April, 1977. i JAMES A. ELSON , MAYOR ATTEST: b ( Sue C. Peter, City Clerk 1$ 1 ,i r F '1 I, f f I .. .i M , a H a �14:`+ CITY OF KENAI I RESOLUTION NO. 77-81 BE IT RESOLVED BY THE COUNCIL OF THE CITY OF KENAI , ALASKA, THAT THE FOLLOWING TRANSFER OF MONIES BE MADE WITHIN THE 1976-77 GENERAL FUND BUDGET. FROM: Library - Operating Supplies ($200) TO: Library - Office Supplies $200 The purpose of this resolution is to transfer funds within the Library budget for the purchase of catalog cards. PASSED by the Council of the City of Kenai, Alaska, this 6th day of April, 1977. JAMES A. ELSON, MAYOR ATTEST: Sue C. Peter, City Clerk N I CITY OF KENAI RESOLUTION NO. 77-52 BE IT RESOLVED BY THE COUNCIL OF THE CITY OF KENAI, ALASKA, THAT THE FOLLOWING TRANSFER OF MONIES BE MADE WITHIN THE 1976-77 GENERAL FUND BUDGET. FROM: .t City Manager - Transportation ($250) TO: City Manager - Miscellaneous $250 The purpose of this resolution is to transfer funds within the City Planager's Budget to purchase training materials from the International City Management Association for Small Cities Management Training Program. i' PASSED BY THE COUNCIL OF THE CITY OF KENAI, ALASKA, this 6th day of t April, 1977. i JAMES A. ELSON, MAYOR ATTEST: I ` Sue C. Peter, City Clerk ` 'i I I I. .i v- 0 n 0 r CITY OF KENAI BID - JANITORIAL CONTRACT KENAI 1JUNICIPAL AIRPORT TERMINAL BUILDING 1977-1978 DATE: !� . 1971 CONTRACTOR: M _ ADDRESS: PJ p Ke v►�� Q� ; TELEPHONE NUMBER: ,j , 6 BID: YEAR: L J MONTH: PER SQUARE FOOT PER MONTH: • /Pig t , , (SiSnaturo) s - i F� 7 ( f it IL - � - - •.-'.`... - -_.. �� .a. LII. �YSIII�!-. - __ I I I I I I ��vl�j !✓Yl��� 7,V 0 6s7 70 J N CITY OF KENAI I ±I SID - JANITORIAL CONTRACT KENAI MUNICIPAL AIRPORT TERMINAL BUILDING 1917-1976 'j i i rynn DATE: C• �t�� CONTRALTO \ ,y,,,,J% %�/� C „� f � ADDRESS: r M1��y FrY'!1 !,' TELEPHONE NUMBER: i SID: YEAR: `. �. ) C, MONTH: PER SQUARE FOOT PER MONTH: I (sigllure) � F wIL grWN-0i1E!4l _. II - I. ...._V! .I__ CITY OF KENAI BID - JANITORIAL CONTRACT KENAI MUNICIPAL AIRPORT TERMINAL BUILDING 1977-1978 DATE: i CONTRACTOR: 4 l tc ADDRESS: 90X ;pdf,�i✓oXic- TELEPHONE NUMBER: d'd yj, BID: 00 YEAR: % — /y%op ��Gi �'a ./ MONTH: PER SQUARE FOOT PER MONTH: �I8 A%.. By: (Signature) I v S CITY OF KENAI I' i BID - JANITORIAL CONTRACT KENAI MUNICIPAL AIRPORT TERMINAL BUILDING 1977-1978 i i DATE: CONTRACTOR: -� r - Y �•. ADDRESS: TELEPHONE NUMBER: BID: YEAR: All, loc% -' ,�/ MONTH: f/ /, Yee PER SQUARE FOOT PER MONTH: U r' By: (Signature) ffiLI.+ III i h I I LL._IL d I i LE i CITY OF KENAI IIID - JANITORIAL CONTRACT ' KENAI MUNICIPAL AIRPORT TERMINAL BUILDING ?� 1977-1978 i' DATE: April 7, 1977 CONTRACTOR: SERVICEMASTER OF KENAI ADDRESS: P.O. Box 537 (Accross from Old Russian Church) TELEPHONE NUMBER: 283-7477 X3,31 BID: YEAR: July 1977 thraigh June 1978 MONTIi: 0.947. 58 PER SQUARE FOOT PER PRANTH: 32.75 0 Considering carpet cleaning, window cleaning, lawn care and care df walks as "additional services", actual cost of daily, weekly and monthly services on building alone would come to 29.62 ¢ per sq& ft* per month. SERVICEMASTER OF KENAI Across from Old RusL;in Church P. O. Box. 537 238-7477 Menai, A!aska "21t Cleaning Peuj,le Wfio Care" 9 k. i'. �aw+.���� a _:.:; .....•. • . ,, .. __...:... i. llR,R9911!Il.l=1A-! L_ I i � i - { 1J :I CITY OF KENAI BID - JANITORIAL CONTRACT KENAI MUNICIPAL AIRPORT TERMINAL BUILDING 1977- 1978 a DATE: CONTRACTOR: ADDRESS: P TELEPHONE NUMBER: rJ �o 3S ' 1 . BID: YEAR: A% �/ �% % 130 MONTH: PER SQUARE FOOT PER MONTH: . 3� y 0 , ov m 0 y R• .; By: csinacure) �• ,_ . �I TIMOTHY J. ROOERS i f •- 3 • 'j j } ROGERS & BALDWIN ATTORNEYS AT LAW POST OFFICE BOX 1261 KENAI.ALASKA 39611 T9L9PM0NI 907] 263.7167 March 21 1977 Sea-Land Freight Service P. O. Box 1087 Kenai, Alaska 99611 Attention: Charles Ogle Dear Mr.Ogle: C R. BALDWIN At the request of Max Swearingen, Pat O'Connell and Shirley Morgan, Lessees of Lot Eight (8), Block Three (3), Cook Inlet Industrial Air Park Subdivision in Kenai, Alaska, I am submitting to you this proposal to sublet a portion of the above-described premises. My clients propose to sublet to you that portion of the above described property which lies behind the present building, for the purposes of parking empty trailers. They will agree that you will be provided with 24-hour access to the premises. Any improvements to adapt the property to your needs will be done at your own expense. My clients will agree to pay all taxes, assessments and other state and municipal charges against the property. The rental amount will be $1,200.00 a year, payable annually in advance or semi-annually with the first such payment due on or before the first day of the term, and the second such payment due within six months of the first payment. The term of the sublease is negotiable. The foregoing proposal is made contingent upon the consent of the City to the proposed transaction, which consent is required pursuant to 93 of the Master Lease dated September 24, 1968. CRB: jh cc: Max Swearingen Q P. O. Box 1341 '. Kenai, Alaska 99611 ! Q I Very s, C. R. BALDWIN Attorney at Law 1 �I LEASE AGREEMENT 3 THIS AGREEMENT, entered into this „ day of 019771 by and between MAX SWEARINGEN, PATRICK M. O'CONNELL, and SHMLEX L. MORGAN, a partnership, whose address is Box 1841, Kenai, Alaska, hereinafter referred to as "Landlord"; and SEALAND PREIOHT SERVICE, INC., an Alaska Corporation, whose address is P.O. Box 1087, Kenai, Alaska, hereinafter referred to as "Tenant". 1. The Landlord hereby lapses to the Tenant, the area which il is outlined in red on Exhibit A, attached horeto, hereinafter called 11 the "leased property", constituting a portion of the following -described 1; Property: I a i Lot Eight (8), Block Three (8). Cook Inlet industrial Air Park Subdivision, Kenai hecording Dirtrict, Third Judicial District. State of Alaska, constituting square feet. Moro or less. 2. Except as provided herein, at the commencement of the term. the Tenant accepts the premises in their existing condition. No representation, statement or warranty, express or implied, has been made by or on behalf of the Landlord as to such condition, or as to the use that may be made of such i property. Tenant has fully inspected said promises. S. The term of this Lease shall be for one year, commencing on the let day of April. 1077, and ending on the 81st day of March, 1078, union sooner terminated as herein provided. In addition, the Tenant shall have an option to renew the Lease Agreement for an additional term of one (t) year. The option to renew shall be exercised in writing on or before March It 1078, by delivering a notice of intent to exercise said option to the Landlord. 4. The Tenant shall pay to the Landlord annual payments in the amount of ONE THOUSAND TWO HUNDRED and NO/100tha DOLLARS (,11,200.00) per year on the lot day of each year during the term of the lease, or any j extension thereof. The (trot payment shall be due on the lot day of April. 1077. !! Page One, LEASE I I F, i 5. At the expiration of the lease term, the Tenant shall surrender the leased property in as good condition as it was in at the beginning of the term, reasonable use and wear and damages by the elements excepted. Any I improvema>i,ts shall enure to the benefit of the Landlord. ! ' 0. No major alteration, addition or improvement to the leased ' property shall be made by the Tenant without the written consent of the 1 Landlord. 7. The Tenant shall indemnify the Landlord against any mechanic's liens, or any other lion arising out of the making of any alteration, d repair or addition by the Tenant. 1 6. It the leased property shall be deserted or vacated, or U 1 proceedings are commenced against the Tenant in any court under a Bankruptcy ! h Act, or for the appointment of a trustee or receiver of the Tenant's property. II either before or after the commencement of the lease term, or if there shall be a default in the payment of rent or any part thereof for more than thirty (30) days after written notice of such default by the Landlord, or U there shall be �Idefault in the performance of any other covenant, agreement, condition, rule, or regulation heroin contained or hereafter established, on the part of the 1 i Tenant for more than thirty (30) days after written notice of such default by the Landlord, this Lease (if the Landlord so cleats) shall thereupon become null and void, and the Landlord shall have the right to re-enter or repossess the leased property. 0. It there shall be default in the performance of any covenant, agreement or condition heroin contained on the part of the Landlord for more then thirty► (30) days after written notice of such default by the Tenant. this Lease (if the Tenant so oleate) shall thereupon become null and void, and the Tenant shall have the right to vacate the leased property and terminate this (Lease. Page Two, LEASE t• I f 10. The Landlord shall be responsible for all taxes, utilities aFsessments, or other state and municipal charges against tate property. 11. No subsequent transfer of the title to the property referred to herein shall affect the right of the Tenant to continue In possession under this Lease. 12. At the termination or expiration of the Lease, the Tenant may i remove all equipment and trade fixtures owned or provided by the Tenant. 18. The Tenant may peaceably and quietly have, hold and enjoy ' the promises for the term or terms of this Lease. 14. Any notice or demand which, under the terms of this lease or under any statute may, or must be given or made by the parties hereto must be in writing and may be given or made by mailing the same by registered i or eortifted mail, addressed to the other party at the address hereinabove I' mentioned. 15. If the whole or a substantial part of the demised premises shall be taken for any public or quasi -public use. under any statute, or by fright of eminent domain. or private purchase in liou thereof by a public body vested p sted with the ower of eminent domain, then, when possession shall be taken i 1� �. thereunder of the demised promises, or any part thereof, the term herein demised and all rights of the Tenant hereunder shall immediately cease and iterminate, and the rent shall be adjusted In the event of such occurrence. t Nothing heroin contained shall be deemed or construed to prevent the Tenant 1 from interposing or prosecuting in any condemnation proceedings a claim for the value of any fixtures or improvements Installed in or made to the domised premises. 18. The demised promises shall be used or occupied only for the storage and parking of trailers and any activity reasonably related thereto. 17. Tenant shall, at Tenant's own expense take good care of the s demised promises, and maintain the promises in a clean and slightly condition, I Page Three, LEASE In M E� 10. The Landlord shall be responsible for all taxes, utilities aFsessments, or other state and municipal charges against tate property. 11. No subsequent transfer of the title to the property referred to herein shall affect the right of the Tenant to continue In possession under this Lease. 12. At the termination or expiration of the Lease, the Tenant may i remove all equipment and trade fixtures owned or provided by the Tenant. 18. The Tenant may peaceably and quietly have, hold and enjoy ' the promises for the term or terms of this Lease. 14. Any notice or demand which, under the terms of this lease or under any statute may, or must be given or made by the parties hereto must be in writing and may be given or made by mailing the same by registered i or eortifted mail, addressed to the other party at the address hereinabove I' mentioned. 15. If the whole or a substantial part of the demised premises shall be taken for any public or quasi -public use. under any statute, or by fright of eminent domain. or private purchase in liou thereof by a public body vested p sted with the ower of eminent domain, then, when possession shall be taken i 1� �. thereunder of the demised promises, or any part thereof, the term herein demised and all rights of the Tenant hereunder shall immediately cease and iterminate, and the rent shall be adjusted In the event of such occurrence. t Nothing heroin contained shall be deemed or construed to prevent the Tenant 1 from interposing or prosecuting in any condemnation proceedings a claim for the value of any fixtures or improvements Installed in or made to the domised premises. 18. The demised promises shall be used or occupied only for the storage and parking of trailers and any activity reasonably related thereto. 17. Tenant shall, at Tenant's own expense take good care of the s demised promises, and maintain the promises in a clean and slightly condition, I Page Three, LEASE In M and not allow to accumulate thereon any trash, junk, or other unsightly debris. IN WITNESS WHEREOF, the parties have horeunto sot their hands and seals, on the day and year first above mentioned. MAX SWEARINGEN, PATRICK O'CONNELL and SHIRLEY L. MORGAN, a Partnership, LANDLORD i, By MAX SWEARINGEN, PAitTNEK SEALAND FREIGHT SERVICE, INC. BY TITLE NAME STATE OF ALASKA ) as. THIRD JUDICIAL DISTRICT ) THIS IS TO CERTIFY that before me, the undersigned, a Notary Public in and for the State of Alaska, duly commissioned and sworn as such, personally appeared h1AX SWEARINGEN, known to me to be a partner of the Partnership that executed the within instrument, and known to me to be the i� person who executed the within instrument on behalf of the Partnership therein II named, and acknowledged to me he was authorized to execute the same on 1! behalf of the Partnership. IN WITNESS WHEREOF, I have hereunto set my hand and affixed my official seal, this ..... day of , 1077. I1 NOTARY PUBLIC FOR ALASKA My Commission Expiross ' STATE OF ALASKA ) ss. THIRD JUDICIAL DISTRICT ) THIS 18 TO CERTIFY that before me, the undersigned, a Notary Public In and for the State of Alaska, duly commissioned and sworn as such, personally appeared , known to me to be the f of the Corporation that executed the within j f' Instrument on bohalf of the Corporation thoroin named, and acknowledged to me Pogo Four, LEASE t -- - - .- . and not allow to accumulate thereon any trash, junk, or other unsightly debris. IN WITNESS WHEREOF, the parties have horeunto sot their hands and seals, on the day and year first above mentioned. MAX SWEARINGEN, PATRICK O'CONNELL and SHIRLEY L. MORGAN, a Partnership, LANDLORD i, By MAX SWEARINGEN, PAitTNEK SEALAND FREIGHT SERVICE, INC. BY TITLE NAME STATE OF ALASKA ) as. THIRD JUDICIAL DISTRICT ) THIS IS TO CERTIFY that before me, the undersigned, a Notary Public in and for the State of Alaska, duly commissioned and sworn as such, personally appeared h1AX SWEARINGEN, known to me to be a partner of the Partnership that executed the within instrument, and known to me to be the i� person who executed the within instrument on behalf of the Partnership therein II named, and acknowledged to me he was authorized to execute the same on 1! behalf of the Partnership. IN WITNESS WHEREOF, I have hereunto set my hand and affixed my official seal, this ..... day of , 1077. I1 NOTARY PUBLIC FOR ALASKA My Commission Expiross ' STATE OF ALASKA ) ss. THIRD JUDICIAL DISTRICT ) THIS 18 TO CERTIFY that before me, the undersigned, a Notary Public In and for the State of Alaska, duly commissioned and sworn as such, personally appeared , known to me to be the f of the Corporation that executed the within j f' Instrument on bohalf of the Corporation thoroin named, and acknowledged to me Pogo Four, LEASE t 4 that such Corporation executed the some pursuant to its by-laws and by authority of its Board of Directors. IN WITNESS WHEREOF, I have hereunto sot my hand and affixed my official seal, this day of 1977. NOTARY PUBLIC FOR ALASKA My Commission Expires: CONSENT TO ASSIGMTENT The CITY OF JXNAI gives its consent to the above Assignment, as well as all other prior Assignments for the purpose of the original Lease above described. CITY OF KENAI By JOHN E. WISE, City Manager STATE OF ALASKA so. THIRD JUDICIAL DISTRICT THIS 19 TO CERTIFY that before me, the undereirned, a Notary Public in and for the State of Alaska, duly commissioned and sworn as such, personally appeared JOHN E. 1WHE, known to me to be the City Manager of the CITY OF KENAI, an Alaska Municipal Corporation, and known to me to be the person who executed the foregoing instrument pursuant to his authority as City Manager. IN WITNESS WHEREOF, I have hereunto sot my hand and affixed my official seal, this _day of NOTARY PVVLIC F01t ALASKA My Commission Expirost Page Five, LEASE I r AGREEMENT AND CONSENT TO ASSIGNMENT OF LEASE 1 THIS AGREEVIMT AND CONSENT TO LEASE executed this day of , 19 . betweenCT KEN hereinafter cal:::. "Lessor" andOF the S�?E OF ALASKA, represented by the Director, { Division of %s iness Loans, Departr�nt of Commerce and Economic Development. here- inafter called Assignee;" WITNESSETH WAMAS.:essor on a to be X24 �6>3 . x=,entered into a tease of the premises at Kenai , Alaska, described as follows: Lot S. Block 3. Cook Inlet Industrial Air Park, in the City of Kenai, filed in the Kenai Recording District, Third Judicial District, State of Alaska. to% g lessees, for term o vsf _3g five 5g years, caasenc ng seatember 24 1968 : and WHEREAS. the said Lessees have assigned their interest under such lease to Assignee as security for a loan in the principal sum of One Hundred Thousand ($100,000.00) DOLLARS, a copy of which assiganent is annexed hereto; and WHEREAS, the parties hereto are desirous of entering into an agreement re- specting their interests with respect to such assignment, IT IS AGREED: 1. Lessor does hereby consent to said assignment as collateral security for the purposes specified therein. 2. By virtue of said assignment, Assignee shalt incur no obligations of Les- sees under said lease, and Lessees shall remain liable for the rent and other ob- ligations of Lessor under said lease. Upon the entry into possession of the prem- ises by Assignee under the provisions of said assignment, Assignee shall be subject to and be governed by the provisions of the lease in the same manner as though they i were the original Lessees. ~�I 3. In the event Assignee enters into possession of the premises under the as - j signment, Lessor wilt grant unto Assignee the consent mentioned in paragraph 9 of 1 said lease. f 4. In the event of the default or claim by Insor of default by the Lessees i of their obligation under the lease, Lessor wilt tmt terminate said lease without f giving Assignee written notice of the default or claim of default, specifying the particulars thereof, and allowing Assignee ninety (90) days from the receipt of such notice to cure the default or claim of default. However, no part of this i paragraph is intended to imply nor does it imply fbat Assignee is or will be li- able for the performance or nonperformance of Lessees of any of the terms, con- ditions or obligations imposed upon Lessees by said lease. Nor shall Assignee Jbe obligated to perform or discharge any obligatiam. duty. or liability under I ■ I 1- I I .I II 1 I �-- - - - -- - the lease or by reason of this assiCnrent and Lessor agrees to inde;rnify Assignee for, and to hold Assignee harmless from. any liability. loss, or damage which -ay be incurred under said lease or by reason of this assignment and from any clair,s i• and demands which -ay be asserted against Assignee by reason of any alleged ob- ligations or undertakings to perform or discharge any of the terms, covenants, or agreements contained in said lease. 5. In the event said lease be terminated by virtue of Lessees' failure to cure default within the timespecified above, Lessor hereby agrees to enter into a lease with Assignee within thirty (30) days of termination of said lease. All ' terms. covenants and provisions of the lease so entered into shall be the same as said lease with the exception of the named Lessees. Lessor BY: STATE OF ALASKA, DIVISION OF BUSINESS LOANS - ASSIGNEE BY: STATE OF ALASKA � sa THIS 1S TO CERTIFY, that before me, the undersigned, a Notary Public in and for the State of Alaska, duly commissioned and sworn, personally appeared to me known to be the and , to me known to be the of , the Lessor named in the foregoing lease, and they acknowledged to me that they executed the same for and on behalf of said Corporation as the and of said Corporation, under authority of said Corporation so to do granted by the Board of Directors, as the free and voluntary act of said Corporation. IN WITNESS WHEREOF, I have hereunto set my hand and affixed my official seal this day of , 19 Rotary Public in and for Alaska My commission expires: ' 0 STATE OF ALASKA ss THIS IS TO CERTIFY, that on the day of 19 before me, the undersigned, a Notary Public. duly commissioned and sworn as such. per- sonally came , of the State of Alaska, 01••ision of Business Loans, an agency organized and existing by virtue of the laws of Alaska to me knoarm to be the of said agency and acknowledged that said instrurent was signed on behalf of said agency and the said acknowledged said instrument to be the free act and deed of said agency. IN WITNESS WHEREOF, I have hereunto set my hand and affixed my official seal this day of . 19 I Notary Public in and for Alaska ! My commission expires: i - a i 1: i 4 i STATE OF ALASKA ss THIS IS TO CERTIFY, that on the day of 19 before me, the undersigned, a Notary Public. duly commissioned and sworn as such. per- sonally came , of the State of Alaska, 01••ision of Business Loans, an agency organized and existing by virtue of the laws of Alaska to me knoarm to be the of said agency and acknowledged that said instrurent was signed on behalf of said agency and the said acknowledged said instrument to be the free act and deed of said agency. IN WITNESS WHEREOF, I have hereunto set my hand and affixed my official seal this day of . 19 I Notary Public in and for Alaska ! My commission expires: i - a FA CITY MANAGER'S REPORT - #14 ADMINISTRATION -FINANCE, 1. Public Hearing - Ordinance 330-77 This is the public hearing on the Kenai water supply and watershed protection. Again, this simply provides for mandatory notification to the City for any application for water rights. As such, it gives us protection relative to the requests for water rights, but does not make a tremendous burden on any applicant. 2. Hearing -Ordinance 331-77 This is the special revenue fund hearing entitled Airport Master Plan. This establishes a revenue fund for the State and Federal shares of the master Plan and provides appropriate appropriations so that we may pay those bills as they come due. 3. Ordinance 332-77 Increasing estimated revenues appropriations for the airport land, this ordinance provides for anticipating already received revenues and appropriating them to cover repairs to the door of the warm storage shed. 4. Persons Present/Ted Carson Mr. Ted Carson will appear as a person scheduled to be heard; reference the Rainbow Bar and Grill, which the Council instructed the Administration to file an objection to for renewal of the liquor license due to non-payment of taxes. S. Persons Present/Edward Garnett Mr. Edward Garnett, representing Andy's Flying Service, will speak, apparently, in reference to Council's denial of Andy's lease application. Of interest, you may note that Mr. Udelhoven, representing the other lease, has been in the office stating that he intends to withdraw his lease application on that specific lot. However, we have not received that letter and therefore, can only provide you with general information. There is nothing, obviously, firm at this date. 6. Persons Present/Mr. Billid McCann / Mr. Billie McCann will appear as a person scheduled to be heard. The apparent reference is to the assessment district to protest, perhaps, his individual assessment. 1 �i i' FA CITY MANAGER'S REPORT - #14 ADMINISTRATION -FINANCE, 1. Public Hearing - Ordinance 330-77 This is the public hearing on the Kenai water supply and watershed protection. Again, this simply provides for mandatory notification to the City for any application for water rights. As such, it gives us protection relative to the requests for water rights, but does not make a tremendous burden on any applicant. 2. Hearing -Ordinance 331-77 This is the special revenue fund hearing entitled Airport Master Plan. This establishes a revenue fund for the State and Federal shares of the master Plan and provides appropriate appropriations so that we may pay those bills as they come due. 3. Ordinance 332-77 Increasing estimated revenues appropriations for the airport land, this ordinance provides for anticipating already received revenues and appropriating them to cover repairs to the door of the warm storage shed. 4. Persons Present/Ted Carson Mr. Ted Carson will appear as a person scheduled to be heard; reference the Rainbow Bar and Grill, which the Council instructed the Administration to file an objection to for renewal of the liquor license due to non-payment of taxes. S. Persons Present/Edward Garnett Mr. Edward Garnett, representing Andy's Flying Service, will speak, apparently, in reference to Council's denial of Andy's lease application. Of interest, you may note that Mr. Udelhoven, representing the other lease, has been in the office stating that he intends to withdraw his lease application on that specific lot. However, we have not received that letter and therefore, can only provide you with general information. There is nothing, obviously, firm at this date. 6. Persons Present/Mr. Billid McCann / Mr. Billie McCann will appear as a person scheduled to be heard. The apparent reference is to the assessment district to protest, perhaps, his individual assessment. 1 J' I City Manger's Report - #14 April 6, 1977 Page 2 7. Persons Present/Mr. Hendricks Mr. Hendricks', as a person scheduled to be heard, will speak in reference to the recent resolution by the Planning Commission and by the Council, recommending zoning changes. It is my understanding that he will object to barring development of duplexes, tri-plexes and so forthe and request that action be taken to provide for this type of multi -family housing. S. Pers ons Present/Mr.ogrady Mr. T has been listed as a person scheduled to be heard. Again, this is an assessment matter and will relate to the situation that we had during the assessment hearings regarding Mr. Bill Chape , a5d presumably, will ask for the same relief., 9. Persons Present/Vern Padgett Mr. Vern Padgett, representing Crown developers, is a person scheduled to be heard. This is in reference to a petition shown later as a resolution on the agenda to waive penalty for special assessments on property held by Crown Developers. 10. Kenai Terminal Enterprises Refer here to correspondence from Mr. Baldwin, representing Brian Peek of Kenai Terminal Enterprises, and I would propose that the matter be discussed in executive session during the laity Manager's Report. U. Ordinance 333-77 This relates to the Parson's petition for special exception relative to deferred assessments on water and sewer. 12. Resolution 77--29 This authorizes refunds to certain property owners in the 1973 assessment district, which the Council tabled at the Administration's request. This is again on the agenda and we recommend, at this time, that the resolution be approved. 13. FAA Building #107 Sale This will be the sale of surplus property at public auction; i.e. the FAA building 0107, currently under lease to the American Legion. , 11 • - - ._ _� ------ _ � — — ., we •�6!ARr_.J?,1 ani,— 1. I I "AI 11,11. M 1111 low City Manager's Report 414 April 6, 1977 Page 3 14. Ordinance 334-77 This is proposed by Councilman Whelan and relates to a referendum to be held at the next general election, providing for the transfer of those funds dedicated to the Civic Center to the Water and Sewer System Improvement Fund. 15. Ordinance 335-77 This provides for a land sale of tax and assessment foreclosed property. Three properties, which were not sold at the last tax sale, have been rescheduled here but at reduced prices. In addition, we have provided for two properties which were foreclosed for assessments on the same sale I am particularly interested in having these publicized at that time to encourage current delinquent assessments to be paid. 16. Resolution 77-45 This provides for transfer of funds from professional services in the Senior Citizens Nutritional Program to the equipment fund. This is to provide for the purchase of a commercial refrigeration unit, a meal -warmer hot box and commercial deep pot sinks. It should be noted that these are capital Improvements which will effect the Fort itself and therefore, will have lasting value to the City. 17. Resolution 77-46 This is a resolution providing for transfer of funds from the Communication Department to the Legislative Department to fund the special election authorized by the Council at their last meeting. 18. Resolution 77-47 This is a resolution authorizing the installation of the water pump at the Ames property to alleviate their immediate water situation. 19. Resolution 77-48 This provides for the confirmation of a telephone poll for payment of $5000.00 to Hutching Sales and Service for the recently arrived police car. 20. Resolution 77-49 This provides for transfer of funds from the Zenat Water Well Project Contingency account to the construction account and authorizes the approval of Change Order #7, which the Council was polled on and later briefed on by the Director of Public works. 0 8 0 4 �r� City Manager's Report - #14 April 6, 1877 Page 4 21. Resolution 77-50 This is the request for the transfer of funds from within the Airport account from Professional Services to Repair and T"nintenance to provide the funds for the High School Mural Painting Project, which will start with a base coat put on by contract and then the actual painting of the murals with the materials furnished by the City. 22. Resolution 77-51 This is the resolution authorizing transfer of monies from Library Operating Supplies to Library Office Supplies to provide funds for the purchase of catalog cards. 23. Resolution 77-52 This authorizes the transfer of funds from the City Manager Transportation Account to the City Manager Miscellaneous Account. These funds are to be used to obtain training materials, which I was briefed on at the Alaska Municipal i City Manager's Association conference in Juneau . It appears to be a very j viable training program and I, therefore, request that the funds be transferred so that I can start this program within the City. 24. Resolution 77-53 This is the resolution prepared at the request of the Crown Developers. 04r. Padgett, who will have spoken earlier as a person scheduled to be heard, 4 will reiterate their request for waiver of penalty in foreclosure action for a period of approximately five (5) months. The resolution has been prepared, so that the Council can take action if they so desire. 25. Outer Continental Shelf Meetings There will be a meeting in Anchorage on April 12-13 on Outer Continental - Shelf, with representatives from the State and Federal governments. I plan to attend these meetings, in that they will be discussing a review of the inter -state allocation processes, which is the method from which planning and development funds will be allocated to the various communities in the State. 26. Detention Facility The Chief of Police, at my request, is proceeding with a budget for a detention facility which, I understand, has the support of not only local legal officials, but also is being supported at the State level. This budget should be prepared within the next two or three weeks and available for the Council shortly thereafter. k. City Manager's Report - #14 April 6, 1977 Page 5 27. Kenai Baptist Temple I have requested the City attorney to reapply to the courts for a bond to be posted by the Kenai Baptist Temple. Aly rationale, in mAking this request, Is that they apparently have a contract for sale of that particular building, which has been the source of contention between the Pity and the Temple. Since the sale to in the process of being consummated, we should try to post with the Court those funds which we may reasonably expect to be due the City as a result of that legal action. 28. Lease Renegotiations At this time, we are sending out letters to all leaseholders whose leases are subject to renegotiation as of July 1, 1977, informing them of our intent to reappraise those properties. Concurrently, we have sent letters out to the appraisers on the Peninsula asking for costs estimates of conducting this job. Presumably, we will have these appraisals started in the near future. 28. FAA Land Development At this time, I have drafted a letter to send ,to all the prospective developers, banks and retail stores, relative to the 28 acres which lie between Kenai Spur, Walker Land and Beaver Loop Road, asking for their interests in the property. Hopefully we will have some major developers respond. 4 `6 1� .q CITY OF KENAI f' RESOLUTION NO. 77-55 BE IT RESOLVED BY THE COUNCIL OF THE CITY OF KENAI, ALASKA, THAT THE FOLLOWING TRANSFERS OF MONIES BE MADE WITHIN THE 1976-77 GENERAL FUND BUDGET. FROM: Police Department - Salaries ($3,000) TO: Non -Departmental - Miscellaneous $3,000 The purpose of this resolution is to transfer funds for the settlement of State of Alaska v. City of Kenai, Civil Action No. 76-15048-I. PASSED BY THE COUNCIL OF THE CITY OF KENAI, ALASKA, this 6th day of April, 1977. JAMES A. ELSON, MAYOR ATTEST: Sue C. Peter, City Clerk r T CITY OF KENAI f RESOLUTION NO. 77-54 a 2 A RESOLUTION OF THE COUNCIL OF THE CITY OF KENAI, ALASKA, AUTHORIZING SETTLEMENT OF THE PEP SUIT WITH THE STATE OF ALASKA FOR $3,000.00. WHEREAS, the City has been involved in litigation with the State of Alaska over monies expended by the City under the PEP program during the years 1971 - 1973, (State of Alaska v. City of Kenai, Superior Court Action No. 76-15048-1). and WHEREAS, the State is now willing to dismiss this lawsuit against the City if the City will pay to the State $3,000 in attorney's fees, and WHEREAS, the Council finds that it is in the best interests of the City to settle the suit for that amount. NOW, THEREFORE, BE IT RESOLVED by the Council of the City of Kenai, Alaska, that the City Attorney is hereby authorized to settle State of Alaska v. City of Kenai (Civil Action No. 76-15048-I) for the amount of $3, 000 and that the Administration is hereby authorized to issue a check to the State of Alaska in the amount of $3, 000 in full and final settlement of any and all claims which the State of Alaska may have against the City of Kenai arising out of the acceptance and utilization of federal funds by the City of Kenai under the State of Alaska PEP program during the years 1971 to 1973. PASSED BY THE COUNCIL OF THE CITY OF KENAI, ALASKA, this 6th day April. 1977. JAMES A. ELSON, MAYOR ATTEST: Sue C. Peter, City Clerk a KFNAI PRN11iS11LA BOROtICH AGENDA FOIL TIII', REGULAR 1• iXTINC: OV THE ASSEMBLY APRIL. 5, 1977; 7:30 P.M. BOHOUGII ADMINISTHATION RUTLDING P.O. AOX 850 SOLDO'1'NA, ALASKA 99669 -- A G F. N D A - - (a) Ord. 77-14 "An Ord. Amending Sec. 16.28.010 of Kenai Peninsula Borough Code by Renumbering the Section and Making it Applicable to Service Areas " (b) Ord. 77-15 "An Ordinance Concerning Rez ming Within the City of Seward" (Federal Addition, Blk 17, Lots 4,5,6) (c) Ord. 77-16 "An Ordinance Concerning Rezoning Within the City of Soldotna" (Iris Heights Sub) (d) Ord. 77-17 "An Ordinance Concerning Rezoning Within Oic City of Homer; (Lots 7E,7F,Shelford Sub.; Lots 7G,7H 6 9A, Shelford Sub 1968 Revised,L LOt 9 Svedlund Sub amended) (e) Ord. 77-18 "An Ordinance Amending Kenai Municipal District Toning Code Chapter 21.76, Kenai Peninsula ^� Borough Cede of Ordinances. (f) Ord. 77-19 "An Ordinance to Provide an Updated Zoning Map for. the Homer District as.a Part of the Kenai Peninsula Borough Code" ASSEMBLY Crawford 4 A. CALL TO ORDER & ROLL CALL Davis 9 Douglas 9 B. PLEDGE OF ALLEGIANCE' AND/OR OPEN.CERVIONY Elson, Jim 10.67 Elson, JoAnn 10.6E C. SEATING OF NEW ASSEMBLYMEN Fields 9 Fischer 9 D. AGENDA APPROVAL Mc AAI ister 11 McCloud 7.5 E. MINUTES: MAR. 8, Mar. 15, 1977 Mika 9 O' Llonne l l 9 F. ORDINANCR HEARINGS: Oldow 7.5 Thomas 10.67 (a) Ord. 77-10 "An Ordinance Making Branson 9 a Supplemental Appropriation from Cooper 10 Unappropriated Punds to the Plan- Corr 9 ning Department of $30,000 for Matching EDA Title IX Planning Funds and $15,000 for Matching OCS-Coastal Management Grant Funds" (b) Ord. 77-11 "An Ordinance Appropriating Funds to the Dept. of Public Works -Solid Waste Div. for Current Operating Expenses" G. INTRODUCTION OF ORDINANCES (a) Ord. 77-14 "An Ord. Amending Sec. 16.28.010 of Kenai Peninsula Borough Code by Renumbering the Section and Making it Applicable to Service Areas " (b) Ord. 77-15 "An Ordinance Concerning Rez ming Within the City of Seward" (Federal Addition, Blk 17, Lots 4,5,6) (c) Ord. 77-16 "An Ordinance Concerning Rezoning Within the City of Soldotna" (Iris Heights Sub) (d) Ord. 77-17 "An Ordinance Concerning Rezoning Within Oic City of Homer; (Lots 7E,7F,Shelford Sub.; Lots 7G,7H 6 9A, Shelford Sub 1968 Revised,L LOt 9 Svedlund Sub amended) (e) Ord. 77-18 "An Ordinance Amending Kenai Municipal District Toning Code Chapter 21.76, Kenai Peninsula ^� Borough Cede of Ordinances. (f) Ord. 77-19 "An Ordinance to Provide an Updated Zoning Map for. the Homer District as.a Part of the Kenai Peninsula Borough Code" ) } AGENDA - April 5, 1477 Page 2. i i *(g) Ord, 77-20"An Ord. Appropriating $42,500 to the •��r�iiKwrti■.r�r-"� -- i � uom � iu�f■ilqu I Planninq Y,, •.t, f5r a Feauifvility Study of the Future Commercial Use of the Propofsed Pacifie Alaska L. N. G. Dock in the North Kenai Arita" (h) Ord. 77-21 "An Ordinance Authorizing an Appro- priation of $389,556 to Complete Funding of the Approved Capital Projects and Additional Projects at Port Graham, Tyonek, and Sterling and Authorizing Capital Transfers Between Approved Capital Projects" (i) Ord. 77-22 "An Ordinance Concerning Rezoning in the City of Kenai" (Northgate Sub, Part 1, Govt. Lot 2, S 1/2 Govt Lot 1 h Lot 3 of Killen rstates Addn. N 1) H. AN APPEAL OF ACTION OF PLANK*TNG COVDIISSIO?l - Douglas Lake Sub., Harry L. Drew I. PUBLIC PRESENTATIONS (a) Rrs. Carolyn Cannava, Kenai Peninsula Borough School District Budget J. COMMITTEE REPORTS: (a) School Hoard, 3/21 (Corr, Fischer, O'Connell) (b) Cook Inlet Air Resources Mgmt, Fist. (Branson,D..vis) (c) O. E. D. P. (Fischer) (d) Sales Tax Committee (Douglas, Cooper, Thomas) (e) Finance Committee (Jim Elson, Mika, O'Connell, Oldow) (£) Legislative Overview Committee (Branson, oldou, McAllister) (g) Parks and Recreation (Corr) (h) Roads 6 Trails/Solid Waste (Fields, Branson, Corr, Crawford, Douglas, McCloud) K. MAYOR'S REPORT (a) Memo 77-51 "Kenai Peninsula Borough Tentative FY 78 Budget" (b) Polar Airways Hearing (c) Borough Land Snlection•Legislation •��r�iiKwrti■.r�r-"� -- i � uom � iu�f■ilqu I I F 1 a I Agenda - April S, 1977 Page 3. L. SCH001. CONSTRUCTION Rt:PORT (a) Furniture. 6 Equipment lists; Bartlett, ilikolae_vrk.. M. OTHER BUSINESS 10 (a) Acknowledge Receipt of School District Budget for PY 77-78 (Motion needed) (b) Ren. 77-19 "A Resolution :,athorizinq the Board of Directors of the Horth Peninsula Recreatio:l Service Area to Expend Purids fon Assisting in the Establishment of a Recreation Proqram at the Tyonek Community Center" N. MAYOR AND ASSEMBLY: Comments and Discussion (a) Excused Absences Requested: Oldom/naviu O. PUBLIC PRESENTATIONS P. INFORMATIO14AL MATERIALS AND REPORTS (a) MINUTES: School Board 3/7/77 and Financial Statement 2/26/77 So. Pen. Hospital 2/16/44 Briar Creek Fire Ser. Area 3/21 3/9/77 N. Pen. Recreation 3/81 3/22/77 (b) RADIO ADVERTISING: KSRM-KOOK. - Radio advertising for borough assembly notices and mesnagen (c) OTHER ITEMS: AML -Directors Meeting 3/17/77 + Legislative Bulletins 9, 9 Collier Hearing Notice 4/13/77 Bureau of Labor Statistics - Food at Home Index 2/77 PAYMENTS IN LIEU OF TAXES- NACO Q. NEXT MEETING: April 19, 1977; 7:30 P.M., Borough Adm. Building. j I 1 ' - f 1 l � The i—lowing are items over $500.00 which need Council al►pf .l or ratification: 4.6-77 VLM11011 AMOl1NT A1:5CRI PT IU11 1'ltQdiiCT/UI:P'1' A/C CIIARGCB MOUNT PO cult Arill(OVAI.: uivision of Lands : 1,030.00 Park rental Non -departmental Rentals $ 1.030,00 i Kenai Branch-L.O.S. 1,488,00 Nutrition Prog. Nutrition Program Prof, Svcs 1,488.00 Cont. Services C112M Hill 3,033.25 Sower Treatmt Plt Sewer Treatment Prof. Svcs 3,033.25 Study a Kenai Utility Service Corporation 1,583.56 Cas chosges for Library Pub. Utilities 94,79 March Council on Aging " " 63.36 police " " 104,54 Fire •' •' 202.93 She 296.31 Water b Sewer " •' 510,08 f Airport Terminal " •• 511.53 Dawson 4 Co. 3,070.16 Workmen's comp Legislative Workmen's comp 4.21 February City Attorney " " 75.55 City Manager " " $5.10 i Finance " " 34.63 Dept of Revenue " " 4.82 Library to of 1.7$ Council on Aging " " 25.41 Communications " '• 23.04 Police " •' 772.50 Fire " " 753.37 Fire Auxiliary to " 6.45 Pit - Admin " •' 50.08 Planning f Zoning" " " 4,75 Streets " " 361.88 Building Inspection " " 35,59 Shop " " 214.58 Animal Control " " 36,46 Water 4 Sower " " 323.79 Sewer Treatment it to 193.64 Airport Term. Mgr. to " 5.27 LDA Capt. Project Project Inspection 67.31 I i I� 1 i i f' t i i is 1 t I I � 1 ' - f 1 l OR RATIFICATION: Central irst reuorat bavings 4 Loan 170,000.00 First Federal Ravings 4 Loan 170,000.00 National Bank of Alaska 200,000.00 Dept of Fish 4 Came 2,179.68 Alaska Municipal Employees Investments Federal Credit Union 4,396.00 National Bank of Alaska 18,2$8.00 Dept of Revenue 3,865.00 Kenai Branch - L.D.S. 1,254.00 witholding 04 liability Federal w/h General fund Federal income tax w/h liability State income General fund State income tax tax w/h w/h liability Nutrition Frog. Livia's Janitorial 1,147.20 Janitorial Svc. Airport Term. Prof. Svcs 1,147.20 March Marathon Oil Co. 6,190.42 February gas Central Treasury Deposits w/Others 6,190.42 _ Union Oil Co. 6,204.37 February gas Central Treasury Deposits w/Others 6,204.37 Homer Electric Assoc- 3,769.76 March utility Dept of Revenue Pub. Utilities 9.23 to n " 120.66 Council on Aging t Police " " 120.05 to 332.46 ' PwrStreets go" 1,013.93 t22.86 shop" �� Stae Ltg Agmt " " 338.22 Water 4 Sower " 896.11 = Airport Term. 638.18 Airport 14 b 0 " " 225.03 Environmental Protection Agency, Region X 1,087.00 CO 00033 74 Refunding- Sewer projectse 1,087.00 Bonds =• 1� OR RATIFICATION: Central irst reuorat bavings 4 Loan 170,000.00 First Federal Ravings 4 Loan 170,000.00 National Bank of Alaska 200,000.00 Dept of Fish 4 Came 2,179.68 Alaska Municipal Employees Investments Federal Credit Union 4,396.00 National Bank of Alaska 18,2$8.00 Dept of Revenue 3,865.00 Kenai Branch - L.D.S. 1,254.00 Purchase CD Central treasury Investments Purchase CD Central treasury Investments Purchase CD Central treasury Investments Fishing licenses Central treasury Sport licenses Credit union General fund Credit union w/h witholding liability Federal w/h General fund Federal income tax w/h liability State income General fund State income tax tax w/h w/h liability Nutrition Frog. Conti. Svcs Nutrition Prog. Prof. Services N1770,000.00 0,000.00 200,000.00 2,179.68 4,396.00 18,256.00 3,865.00 1,254.00 V -- - --- - - -_- - - --- T -- - - r __' 7 - -s" '.'�' r- GAttfny QF Hows k ' . CHUCK JOHNSON ASSOCIATES—REALTORS 1709 Bragaw St. Suite A. Anchorage, Alaska 99504 9071276.2766 i Kana; Or. P.O. Box 3756 Kenai, Alaska 99611 907/283-4606 N i' MAii.;H 259 1977 1 t ROSS A. W1,11SY BUX SFO KENAI, AN. REs ASSE3;f> IS* LM WD DAVID30N SUB. DEAR VA. JaNNEY f I AN SU MMI NG A PPF MAL KWU10i '10 vCp AND TO PHE KENAI aTa MORCIL TO MA XT THE M tAKE9 IN THE AS3ESMUT SI LZI'Mi CN MY i' kSF')rit`i`IES. I UNDMS TAND PRAT Yl %U WILL HAVE TO AMNEND THE ORIGINAL A.S:iMENT ROLL TC DO T -IIS* IT IS M DEMS MAT YOU DO THIS AS SOON AS rOSSISLE AS IT HAS A DIRECT AFFECT ON .�:Y f'dOfbaTIE 3 SAL ASULI . >�! I AM SUBMITTING MIS LETTER TO YOU AND THE CITY COUNCIL. MUG THAT v.z mP'.Kit BE RANDELED A3 SOON Ali P033I818a SINCW I FIND THIS s'ISTAKE a }N Y!^i+3 P,�++iT SHOULD f I HAVE TO SEEK LWAL AID 131ALL EKP9CT You TO COVER THE MCFENIS!S. THANK DIV i; F. ENT G ± PROP •RTY .YWNFA COPIESs 4 i U Introduced: 1/25/77 Referred: Community & Regional Affairs 1 IN THE HOUSE BY MALONE 2- HOUSE BILL NO. 110 3- IN THE LEGISLATURE OF THE STATE OF ALASKA 4; TENTH LEGISLATURE - FIRST SESSION Sp A BILL s:Xor an Act entitled: "An Act relating to municipal planning and zoning 7I powers." g BE IT ENACTED BY THE LEGISLATURE OF THE STATE OF ALASKA: 9 * Section 1. AS 29.33.070(b) is amended to read: to (b) The [IF A CITY WITHIN A BOROUGH IS LOCATED MORE THAN 25 MILES 11 FROM A BOUNDARY OF THE BOROUGH SEAT, THE] assembly by ordinance may 12 (1) designate the council of a city within the borough [THE 13 CITY] as a board of adjustment within the city; 14 (2) delegate other planning and zoning administrative and 1s enforcement responsibilities to the city, provided that borough jurLs- ts dictiow is not impaired; 17 (3) withdraw powers delegated under this subsection. is 19 N ee , 20 / C 21 ' 221 #PASS&I TAA JqSMA 23 24! 36 z6- , 3 9 27 28i -1- RB 110 I 396 HOUSE JOURNAL February 25, 1977 Yeas: 26 Akers, Bradley, Brown, Buchholdt, 11008 Chatterton, Cotten. Cowper, Duncan, Eliason, Freeman, Gruening, Guy, McKinnon. Malone, Miles, Miller, Nakak, Oso, Osterback. Parr, Rudd, Schaeffer, Severson. Smith, Snider, Swanson. "aye: 11 Beirne, Bennett, Carpenter. Dankworth, Haugen, Hayes. Kelly. Phillips. Rhode. Specking. Orion. Excused: 3 Gardiner. Lethin, Meekins. And so, HB 108 passed the Nouse. Mr. Hayes gave notice of reconsideration of his vote on HB 108 on the next legislative day. HB HOUSE BILL NO. 110 (mm IDat planning and zoning powers) was read the second time with the Community and Regional Affairs Committee report (page 360 of the journal). Mr. Miller moved and asked unanimous coneent that HB 110 be considered engrossed, advanced to third reading and placed on final passage. There betag no objection, it was so ordered and HB 110 was read the third time. The question being: "Shall HB 110 pass the House?" The roil was taken with the following result: Was,: 36 Akers, Beirne, Bennett, Bradley. Brown, Bucbboldt, Carpenter, Chatterton. Cotten, Couper, Dankvorth, Duncan, uEliason. g� Freeman. Gruening. Guy, i Hayes, Kellyy, McKinnon, Melons Mi es Miller, Nakak, Ose, 08 k. Farr. Aillips. Rhode, Rudd, Schaeffer. Severson, Smith, Snider, Swanson. Orion. Nays, 0 Excuaeds 4 Gardiner. Lethin, Meekins, Specking, And so HB 110 passed the House and was referred to the Chief clerk for engrossment. HS HOUSE BILL 00. 122 (supplementalropriation, Alaska 122 Pipeline Commissions effective date was read the second time with the Finance Committee report (page 383 of the journal). C it t y� t>>L i i c} IL ti P'.Wecf: KENNLTH A. GIDSON Rfayoraf Nererlt Net Pufdeu: U.P. ALEXANDER Mayaof 5)fKUM P"n Pufdeef, MOON LANDRIF U Maya of Nn 01IMS HENRY W. MAIPR Mayor nl Mdraokte JACK D. MALTIATER bbyaf al Stn lexdeo Teaceat. ABRAHAM BFAME Meymol Net, Yak JOHN J. BUCKLEY Maya of to -few. Mut RICHARD CARVER Mayor of Peart RICHARD(i. HATCHER Ma)at of Gary MAYNARD JACKSON Mayor of Affam HARRY KINNLY Maya of Albuquuque PATII:Nce LATTING Mayorof Ol:lah®Ia City RALPH J. PERK Maym of ClOdand G., M. SULLIVAN faayaaf Aeubon(a WLSLLY C UHLMAN Mayas d Salve KEVIN H. WHITE Mayall BosoD WILLIAM H. MCNICHOLS, ChWMAI Maym of Lima HELEN G. BOOSALIS Mayoral Lincoln THOMAS BRADLEY Mayor of Lm Angela WYETH (.HANDLER Mayorol Memphis STANLEY A. CMICH Mayor of (finnan BORIS A. DAVIS Maya of Compton PETP1 F. FLAHERTY Maya ofPmebutgb NEIL Go, waiMIDT Mayor of Ponlared MARGARET NANCS Maymnl Pfutena WILLIAM S. HART, SR. Maym of Enorange JANET GRAY HAVES Mayor of San Jose FRED HOFHRIN7. Mayofof Hoafaf BEN H.LEwH Mayaof RiaHaide,Cail. Lawis C MURPHY Mayor of Tucson JOHN H. FOELKER Mayor of Se Louif JOHN H. RFADING May. of Oaklaatd JOHN P. ROUTAKIS Mayor of 6awnna5 HANS G. TANy.1.BR, JR. Mayoref Jahoattville OUIS J. TULuo L Maya d hie TED C. W ILL$ Maya of Form PETIT WILSON Maya of San Diego COLEMAN A. YOUNG Maya of Dolt Fermi- Difnea: JOHN ).GUNTHER TBLEPHolyr 2e9 (Aam CALK; UNITED STATES CONFERENCE OF MAYORS 1 6 2 0 EYE STREET, NORTHWEST WASHINGTON, D. C. 20006 February 17, 1977 The Honorable James A. Elson Mayor of Kenai P. Oe Box 560 Kenai, AK 99611 Dear Mayor: I am happy to announce that USCH, in cooperation with IND, the National Cofmmunity Development Association, and the Urban Land Institute, will be convening three regional conferences this spring to assist you in carrying out your ever-increasing respon- sibilities in the area of housing. These conferences will bring together a unique blend of practi- tioners from the public and private sectors to discuss housing and local government's role in its development from all angles. Problem solving workshops, combined with general presentations by the experts, will give you the opportunity to compare notes and experiences with your colleagues while exploring new concepts and techniques. You may have attended, or heard about, the six conferences we mounted last fail in this area. I am happy to report that those sessions were extremely well received, and that response has prompted us to repeat them again this spring. This gives you an unexpected chance to attend if you missed the first round, or to send additional staff. In addition to providing the same unique opportunity to learn from and work with public and private officials in the housing and development field, these spring meetings will also contain a new feature. Each one will be held in a city which has demon- strated how comprehensive planning by the city, and cooperation with the private sector, can produce high quality benefits for both parties. A special emphasis has been placed on central city rehabilitation efforts, and there will be private and public sector participants from the cities themselves to run through case studies and show exactly how they did it. I i Page 2 These sessions will not focus just on principles) they will be down-to-earth, nuts -and -bolts working sessions where people who work on the problems will trade information and tips. When combined with the general sessions and workshops developed last fall, these promise to provide an unparalleled learn- ing opportunity. The three cities involved, and the conference dates, ares Hoboken, New Jersey April 13 - 15 Memphis, Tennessee April 20 - 22 Portland, Oregon May 4 - 6 In addition, all conference participants will receive a copy of four guidebooks developed by the USCM staff which cover in detail --for the working local official or staff member --how the private housing market works, and how you can influence it to meet public policy goals. Let me take this opportunity to urge you to attend one of these conferences. If you cannot attend yourself, please consider sending a staff person. I am convinced, based on the feedback I have received from some of the over 700 persons who attended last fall's meetings, that these have been the most important sessions dealing with housing ever mounted by USCM. Space for these conferences is limited, so please don't delay --send in the registration materials as soon as you can. Please note that the registration fee is $65 if you pay when you pre -register by mail. If you choose to pay at the door, the fee will be $80, whether you have pre -registered or not. I have enclosed a copy of the conference agenda, along with a listing of the faculty which will participate at each site. If you have any further ques- tions about these unique conferences, please do not hesitate to contact Ronald M. Gatton, Director, Housing Assistance Staff, at 202/293-5158. c ely, WM00LAaizo V=I Gunther tive Director Enclosures LL L!_I I I ... . _� i r ` USCI -HUD HOUSING w,Vk94WA" ` PORrIAND, OR May 4-6 t THIRD DAY PrdX=M { GENERAL arWJ.,W.1 REVIEW OF PORTLAND'S DEVELOPMENT INITIATIVES 8:00 - 9:00 am A briefing on the various rehabilitation efforts currently underway in Portland through a partnership of public and private sector actors. This will focus on the main points of interest on the tour which follows. WORK SESSION TOUR OF PORTLAND DEVELOPMENT INITIATIVES 9:00 - 11:00 am A guided bus tour of housing rehabilitation/ bru...YGir�a1, and industrial redev+elopnent +..�..a... examples in Portland. Featured will be rehab, adaptive reuse for residential housing, and neigtI.-'l.r 4 residential rehab- ilitation efforts. GENERAL SESSION PANEL PRESENTATION ON PORTLAND'S RESIDENTIAL RENABILITATION 11:15 - 12:00 pm PROGRAN A panel of public and private sector participants in Portland's residential rehabilitation will explain the process through which they brought a particular project to fruition. (PANEL, 104BERSS 70 BE ANNOUNCED.) ` WORK SESSION ROUND TABLE DISCUSSIONS OF PORTLAND'S PROGRAMS 12:00 - 1:30 pm Local city Dev+aloprent Om:mii.ssion staff, private developers, and lenders will conduct round table clinics to answer detailed questions on •Cmm ercial rehabilitation •Neighboxi:ood residential rehab #Adoptive re -use *Financing downtown developient A nuts -and -bolts session for practitioners. l I C' i 1. I� i NWM, IN April 20-22 THIRD DAY PROGRAM GENERAL %44 REVIEW OF MEMPHIS' DEVELOPMLPNT INITZATIUES 8:00 - 9:00 am A briefing on the various initiatives undertaken by the City of Memphis, focusing on partnership efforts between the public and private sectors. This will focus on the main points of interest in the tour which fellows. W= SESSIM TOUR OF MEWHIS DEVELOPMENT INITIATIVES 9300 - 11300 an A guided bus tour of housing and commercial development initiatives undertaken by Memphis. Featured will be a housing replacement program in the city's community development priority areal Operation Break -through sites; private rehabilitation efforts; factory conversion; and downtown commercial redevelopment. GAIL SESSION PANEL PRESENTATION ON A FACTORY CONVERSION TO MIS - 12300 pu RESIDENTIAL HOUSING A panel of public and private sector participants will explore the development of River Row, a privately financed, publicly supported market rate housing develop- ment in old warehouse space on the Memphis waterfront. Panelists will include: Lyman Aldrich, President, Lyman and Aeeociatee, developer l of River Rory Quincy McPherson, Executive Wee -President, Union Ptantere National Bank of Memphis Charter D. Hitt, Deputy Director, City of Memphis Commcnity Development Program Keith ftee, AIA, Project Arohiteot for River Row John Was, Assistant Chief Administrative Officer, City of Mewhis. VORK SESSION ROUND TABLE DISCUSSIONS OF MOMS' PROGRAMS 12:00 - 1330 pn Local city staff, private developers, lenders, and architects will conduct round table clinics to answer detailed questions on: S • Housing Rehabilitation j • Housing Replacement with Relocation Funds •Financing Factory Conversions I( • h'he Developer's ;tole in kactory Conversions • Government's Role in Stimulating Private Investment A nuts -and -bolts session for practitioners I / r GENERAL S WUN 8:00 - 9s00 am WORK w4 9:00 - 11:00 am GENERAL SESSION 11:15 - 12s00 pa WDRR SESSION 12:00 - 1:30 pn ii08, NJ April 13 - 15 THIRD DAY PROM M REVIEW OF HOBO)M'S DEVELOPMENT INITIATIVES A briefing on the various rehabilitation efforts currently underway in Hoboken through a partnership of public and Private sector actors. This will focus on the main points of interest on the tour which follows. TOUR OF HOBO)= DEVELOPINNT INITIATIVES A guided bus tour of housing rehabilitation program examples in Hoboken. Featured will be substantial rehabilitation apartment projects, brownstones renovated by individuals through the city's home improvement loan program, a factory which has been converted to residential housing, and mod- erate rehab in older tenement buildings. several stops are planned en route. PANEL PRESENTATION ON TIRE tewruri.,iil REHAB PROGRAM A panel of public and private sector participants in Hoboken's unique tenement rehabilitation program will explain the process through which they have made this effort work. Panelists includes Joeeph J. Cioala, Direotor, Housing and Neighborhood Preservation, Connrunity Development A&dnistration, Hoboken, NJ Dave White, fteoutive Vioe-President, Waehington Savinge Bank, Hoboken, NJ Martin N. MoCarthy, Esq., Housing ConeuZtant to the Hoboken CDA Thomas WeZZe, AIA, Bissell and WeZZe, Arohiteote, an arohiteoturat ooneuttant to the Tenement Rehab Projeot Sal Santanietlo, Tenement Rehab Projeot Coordinator ROUND TABLE DISCUSSIONS OF HOBO)=IS PROCRAMS Local CDA staff, private developers, bankers, and architects will conduct round table clinics to answer detailed questions on: • Home improvement Loans •Factory Conversions @Tenement Rehab •Housing Management @Commercial Revitalization @Financing A nuts -and -bolts session for practitioners ATTACHMENT III ;i •i I P _ s REGISTRATION t 12:00 Noon opnMIG SESSION 2:00 — 3:00 pm 3:00 — 5:00 pm RECEPTION j 5:00 pm GENERAL SESSION ' 9:00 - 10:00 an I WORK SESSION 10:00 am — 1:00 pm LUNM 100 — 2:00 pm GE14SRAL SESSION 2:00 — 4:00 pm REVISED AGENDA SPRING USCM-HUD HOUSING CONFERENCES HOUSING: PUTTING IT UP OR PUTTING UP WITH IT? A Mayor's keynote presentation on the advantages and disadvantages of a community playing an active role in housing development. LOW A MODERATE INCOME HOUSING: WHAT'S IN IT FOR THE DEVELOPER? Joseph Barry, a successful Hoboken, NJ, rehabilitation developer, discusses how the housing development process works and how he profits from it. SEC= DAY UNDERSTANDING AND INFLUENCING HOUSING MARKET DYNAMICS William Schneider, Executive Director, and Gary Conley, Assistant Director, Dayton City -Wide Development Corp., explore housing market dynamics, factors that cause housing and neighborhood deterioration, and strategies and techniques which communities may use to influence the provision of housing. ANALYZING THE HOUSING MARKET, SETTING HOUSING PRIORITIES, AND CHOOSING STIMULATION TECHNIQUES Workshops using case studies to analyze a local housing market and its dynamics, set appropriate policies to influence them, and choose proper techniques to realize the community's goals. OPEN THE PRIVATE SECTOR VIEW A special presentation and discussion with a developer and lender on how the private sector views housing assist- ance programs, and how local government and the private sector can cooperate to provide housing for all income groups. IHIRD DAY TOUR, PRESENTATION, AND WORKSHOPS ON SUCCESSFUL LOCAL DEVELOPMENT INITIATIVES Private and public sector representatives from the host city will conduct a detailed exploration of a successful public-private development ventures. (See attached agendas for details on eauj;. ''•--' r ity's program.) II Yill 111 LK J1 II_Hill .I, YM LE r OFFICIAL RESERVATION CARO . o ff Riverrnont k 200 W. GEORGIA MEMPHIS, T14.38103 PHONE (901) 525.0121 I (PRINT) ORGANIZATION U. S. Conference of Mayors (PRINT) NAME _ PHONE ( ) (PRINT) ADDRESS CITV STATE ZIP PNew metre the following rownehon Dates of Meeting Anril 20-22, 1977 Single Ron ...... .. $9,,00 Arrival Date ❑ A.M. ❑ P.M. Double Ron......... $22..00 Departure Date � Suite .............. $ — Extra Person....... $ J 6 P.M. Guaranteed Special Instructions U.S. CONFERENCE OF MAYORS BENSONNOTIL MAY 4 - 6, 1 977 PLEASE DESERVE BENSON ACCOMMODATIONS AS CHECKED Mom Poirota Type NAM/ - ARRRitf C11y/fTAf!/tl► C) mom • PAL AMAI CAM Q Milli A PAL ON A UUARANT1i0 PATWNT RAlll UNWN O/ 11/AY Mom MUM THIS CARD Ry Apr I I I )1-r 1977 ` 1/ Ma requested b eN availaavailable,aearnr available rare wig belonsd. RawrvaHeae wnl be hold gain dm P.oa. ad. paTnren► is Raonareed ar revered by doper►. I $35 Single/Twin Occupancy WESTERN WrERNAMONAC HOTELS Partnere In tre"I with United Aldine I A IE FA _ .....�_, --- - •-- -- ----- .-�-- . --_ .� --.rte - -,_ MIKE GRAVE. _ ALASKA i -�---�-�--- - --���--- .��- L!J__!_fl_!J_I,IL..L._I ILII lIIIL111111 II! 02(niieb .dates Asenafe " WASHINGTON. D.C. 20810 1 � 3 I; r4arch 18, 1977 �i James A. Elson, Mayor P. O. Box 580 Kenai, Alaska 99611 w Dear *O*the issue of youth unemployment is one that must be addressed immediately. In this regard, President Carter has offered i a major initiative that includes a program for youth conservation 1 projects, youth community improvement projects and the expansion of youth employment services. For your information, I have enclosed a copy of the President's message to Congress. Hearings are expected to take ' place before April 1 and action on the legislation will follow soon thereafter. I will keep you informod of further developments as they occur. Warm regards. Sincerely, z Mike Gravel Enclosure r— Id ERBAP.GOED FOR USE AT 10.30 A.M., MARCH 9, 1977 Office of the White House Press Secretary THE WHITE HOUSE TO THE CONGRESS OF THE UNITED STATES: As part of the economic recovery package I sent to Congress on January 31, I requested $1.5 billion, to be spent over an 18 -month period, for new youth unemployment programs. This reflected my concern about continued high unemployment rates among our young people. Unemploy- ment for those between the ages of 16 and 19 is now 18.5 percent, and a total of 3.4 million people aged 16 to 24 are out of work. Today I wish to outline the programs we intend to begin as soon as these funds are made available. They include proposals developed in the Congress. Under the wide discretion granted by Title III of CETA, we are able to begin these programs without additional legislation. But because I believe that full Congressional participation is essential for projects of this magnitude, I will soon present to the Congress my request for specific authorizing legislation. Although a wide variety of agencies have programs for unemployed youth, most are carried out by the Department of Labor. During Fiscal Year 1976, some two million young people took part in programs under the Comprehensive Employment and Training Act. These Included: -- 160,000 in public service jobs -- 5009000 in work experience programs -- 200,000 in on-the-job and classroom training programs -- 40,000 in the Job Corps -- 1,135,000 in the Summer Neighborhood Youth Corps programs. We are recommending two changes in these ongoing efforts: first, an increase of $342 million for the Job Corps, which will double the program, and second, a one-year extension of the Comprehensive Employment and Training Act, which was made law in 1973 and expires this year. CETA established a new system under which states and local communities are responsible more --- V 2 i for planning and operating their own employment and training programs. I have asked the Congress for this one-year extension to give us time to review the program and consider what steps would make it most responsive to the problems of the unemployed. Beyond these changes, we must take a broad look at Federally -funded employment and training programs for our young people. My Administration is now proposing three new initiatives, developed in consultation with Congressional leaders, which we can begin under current legislative authority but for which we will seek a specific legislative mandate. First -- A National Youth Conservation Corps, similar to the'Civvilian Conservation Corps of the 1930's. This would be administered by the Department of Labor through agreements with the Agriculture and Interior Departments and on State park and forestry lands. The Youth Conser- vation Centers would employ young Americans aged 16 to 24 in conservation programs and in the maintenance and im- provement of public parks, forests and recreation areas. We plan to spend $350 million over the next 18 months for 35,000 jobs under this plan. Second -- Youth Community Conservation and Improvement Projects, developed by State and local govern nme t would employ those aged 16 to 19 in well-planned, well -supervised projects of obvious local benefit. Funds would be available for needed supplies and equipment. Projects would include improving neighborhoods and communities and maintaining and restoring natural resources on publically owned land. Rural as well as urban governments would be eligible; both would submit applications to the Department of Labor M through the CETA system. We would concentrate these projects where the need was greatest, but they would be open to all unemployed youth. Between now and October of 1979 we plan to spend a total of $250 million for 30,000 jobs. Third -- Comprehensive Youth Employment and Training, Pros, through the CETA system to enlist a`iull range A of employment services in states and local communities to provide young people with jobs and training. As with our current CETA program, community-based organizations and other local agencies would be eligible ! to operate job programs. This plan would be aimed at disadvantaged or low- income Americans between the ages of 16 and 21 who are out of school and out of work. Half the funds would be allocated to the 466 prime sponsors under the CETA system. The allocation formula would be based on the unemployment rate and proportion of poor people in each area. The other half of these funds would be used by the Secretary of Labor to encourage innovative and experi- mental programs. Three-quarters of the money would be . spent through the CETA system, on the basis of applications to the Secretary. These applications would be judged by I the standards of local need, program quality, and the ! prime sponsor's record. The Secretary would use the rest of the money to carry out and test innovative projects. more JIMMY CARTER THE WHITE HOUSE, March 9. 1977 i I � � N a r 3 We are planning to spend $900 million for 138,000 such jobs. While implementation can proceed promptly under the existing authority of Title III of CETA, by April 1 of this year I will submit to the Congress a new title to the Comprehensive Employment and Training Act, embodying these three new youth initiatives. In developing this legislation I have directed the Secretary of Labor to work with interested members of Congress and the public. ' In March 1933, in a message to Congress proposing the Civilian Conservation Corps, President Roosevelt said: "It (the C.C.C.) will conserve our precious natural resources. It will pay dividends to the present and future generations. ...We can eliminate to some extent at least the threat that enforced idleness brings to spiritual and moral stability. It is not a panacea for all the unemployment but it is an essential step ..." It is in that spirit that I send this message to Congress on our youth employment programs. JIMMY CARTER THE WHITE HOUSE, March 9. 1977 i I � � N a = ska Nouse o• L7PQ�{i{ii�QY el HUGH MALONE March 29, 1977 James A. Elson, Mayor City of Kenai P.O. BOX 5$0 Kenai, Alaska 99611 Dear Mayor Elson: Thank you for sending me the City Council's resolution on limiting tort liability of the municipalities (No. 77-35). Z appreciate your position on this matter. POUCH V JUNEAU 69611 P. O. BOX 9 KENAI 99611 I J Mayor James Elson City of Kenai Kenai, Alaska Dear Jim: I understand that you spoke with Tim McKeever of my staff about your city's water line and well development projects. I hope you will contact us if you need any assistance with the Economic Development Administration. With best wishes, ;��d-a ly, T T SEVENS S i it e;rStates Senator it i. ILLI 011111 1 11 1110111 AIMIL.UCCUISAXANX.CI INIMIMI, OMVOX*,T=9h*LVAX. jaw 0.01 "k%miss. *=WL.$ORXK%$WW. xMO.r*STG^*A. ciff"MV6=216" OWWWO.OMM-WA. WM 2enueb Siaigz Isom& =§&ULW"UAMff. A- PIM -111I WIM JOW"INIPLUM. C"x= "COOMWASIAII OMEL IL POOM "AWAII RUI O. ockPI VJ6 COMMITTIM ON APPROPMA'"ONS Oumv F. "MA" Of. $A. "am 111 IaN.OKI a - WASHING"N. O -C 28018 WIPIP. THOStAs F. WAGUMW. III Lawn"COI JOHMIMLA. • JAU=R.QUAMAT March 11, 1977 I J Mayor James Elson City of Kenai Kenai, Alaska Dear Jim: I understand that you spoke with Tim McKeever of my staff about your city's water line and well development projects. I hope you will contact us if you need any assistance with the Economic Development Administration. With best wishes, ;��d-a ly, T T SEVENS S i it e;rStates Senator it i. JONN L. MCCLt LLAH. ARIL. LDA1RMAN WARREN O. MAONUEON. WASH. MILT011 fl. YOIJMO, N OAK. JOHN C. SUNNIS. MISS. CLIE/ORDP. CASE. N.J. RODEAT C. OYRD. W, VA TOWARD W. ORDORI. MASS. WILLIAM PROXMIRE. WIS. MARK O. HAT/ULD. ORIG. K. INOUEi. HAWAII S. ALASKA GIELES ERNIELES [flF[ST F. ffOtNNDII. S.C- HA M CHARLES MCC MATHIAS, /R., MD. OIRCH DAYH. IND. RICHARD S. CCHW/IKt R. PA. THOMAS V. FAGLETON. MO. HENRY OELLMON. ON". LAWTON CHILEe. I. LOWELL P. WEICKER. JR. CONN. COMMITTEE ON APPROPRIATIONS J. SINNLTT JOIINSTON, LA. WALTER D. HUJDLE6TON. KY. WASHINGTON. O.C. 20510 OUENTIN N. BURDICK. N. OAR. PATRICK J. LCANY. VT. JAMES R. SASSER. TENN DENNIS OECOMINI. ARIL. JAMES R. GALLOWAY March 1% .. 1977 CNIP.P COUNSEL AND STAFF DIRECTOR Honorable James A. Elson Mayor P.O. Box 580 Kenai, Alaska 99611 Dear Jim: I understand that you talked with Tim McKeever, of my staff, concerning the suit brought by the State of Alaska against the City of Kenai for return of monies that were not allocated properly under the PEP program. We have talked with the Department of Labor in Seattle about whether future grants to the State would be withheld from CETA allocations if the State fails to J collect $64,964.38 from the City of Kenai. It is our j understanding that the Labor Department feels that it would be unlikely current funds would be deducted from current CETA grants to the State, as the prime sponsor. If this were to be done a legal question could arise, that would have to be answered by the Solicitor's office of the Department of Labor. We have requested an informal F opinion of the Solicitor. i. Bill Collins, another member of my staff, met with Jess Raymaker and Jim Grim, the Regional Administrator j and the Deputy Administrator of the Employment and Training Division of the Department of Labor for Region X concerning your problem. They explained that there was a discrepancy in the amount of monies owed to the Federal Government because of different audits that were conducted in 1973. ; r ' The Department of Labor's audit shows that the City of Kenai owes $11,285, rather than the $64,964.38 the State claims were not properly allocated under the PEP Program. It was suggested by the Regional Director that it could be beneficial if the State met with them to review the claims and circumstances surrounding each case. It might `,- - be that some claims might be waived. We have since talked I I If t �in�u..0+.1.iA F.IJ •� Honorable James A. Elson t March 17, 1971' Page Two with Richard Burnham, the Assistant Attorney General handling the case for the State, and encouraged him to +" meet with Jim Grim to see what may be worked out to the benefit of the City of Kenai in reducing the amount owed to the Federal Government. You may be assured that we will continue to do what we can regarding this matter. With best wishes, Cordially, TED STEVENS United States Senator i I V - i MANAGEMENT ASSOCIATES OF ALASKA, INC. MANAGEMENT AND INVF.%TMFXT CONNULTANTR THE CALAIS OFFICE. CENTER. NUITE 301. 3201 C STREET. ANCHORAGE. ALASKA 00503 TF.IXPRONR 10071 270.4017 March 18, 1977 The Honorable Mr. Jim Elson Mayor of the City of Kenai Kenai City Hall P.O. Box 580 Kenai, Alaska 99611 Dear Jim: It was a pleasure to talk with you last Wednesday evening at the Kenai City Land Auction. Since I had no cards with me at the time, I thought I would drop you a note and say hello again. It seems I find myself spending almost as much time in Kenai these days as in Anchorage. Since last year we have been researching tax delinquent or abandoned properties in Kenai for purposes of reclaiming or refurbishing them, thus making them livable and much more valuable. We have researched with title companies much of the material having to do with chain of title and marketability of title on tax sale or abandoned properties. If under certain circum- stances, we are able to clear the title while working closely with the City, then bank financing could assure much higher property values. This in turn would produce an evermore solid tax base. If I can be of assistance to you and the Council in these matters or in the matter of marketing future foreclosed pro- perties, feel free to contact me at your discretion. You also mentioned that the City Manager, I believe, was to be handling some of these matters in the future. Could you drop me a line and clarify that for me. E If you have any immediate problems or questions, you are welcome to shoot them along also. As always, I remain, Very �1t1 ours' , Ro a A. aker Management Consultant i I HONALII A. BARER --- MANAOSMBNT CONSULTANT n { i{ Or ArruixTrnrr Tun CAwu Omon Cuurna 1007) 070.4017 82010 ST. Surra 801 1007) 840.1844 Arenau&mh AS. 09508 ' . � • J r, a i� 1 /EMM ! ':.:+.! :.r +.,,. ..r.rir ,r.,,l, , Inc. j IPMAFUB AHG 1-021441 A,l,97002 03/28/77 t; ICS IPMNAWA WSH 10093 GOVT NF WASHINGTON DC 35 03-22 542P ESP PMS MR JAMES A ELSON MAYOR CITY OF KENAI PO BOX 5 80 KENAI AX 99611 HAVE BEEN NOTIFIED BY THE ECONOMIC DEVELOPMENT ADMINISTRATION ` THAT KENAI HAS BEEN AWARDED A 359000 GRAM TO HELP CONDUCT A FEASIBILITY STUDY FOR A PERMANENT DOCK IPJ KENAI. EDA OFFICIALS WILL CONTACT YOU WITH DETAILS. SENATOR TED STEVENS ! UNITED STATES SENATOR 1 1807 EST IPMAFUB AHG ,? 79 ,7,) Phone too ..A ,��✓r3 S� Phoncd To...... • ..N... BX -f 4-T ......... ..... Ur,•u1 rad. V, jr '� I f 11-� { 1 f t �t ` •,' IAY & VKHOND, NU NN �-.'i � ( •', � ( ii � :�',�_J [Jia:; l O1Y151ON OP fOCAf GOYERmEN1 as1S1ANCf I POUCH 8 - NNW 99811 9 March 25, 1977 Dear Mayors and Managers of Coastal Communities: The federal office of Coastal Zone Management has requested our assistance in scheduling a meeting of local government officials, state officials, and repre- sentatives of the federal office of CZM . At their suggestion the meetings to be held in Alaska will be April 11 through 13 as follows: Monday, April 11, federal and state officials will meet in Juneau to discuss the federal -state relationship for the Coastal Energy Impact Prog ram . Tuesday, April 12, in Anchorage, at a place to be announced later: federal, state and local representatives will jointly meet all day to discuss, among other things, the section 308 G (2) process and guide lines, the general application forms, fiscal management schedule forms, grant tracking and general data gathering as it relates to the federal allotment process of the CEIP. Wednesday, April 13, in Anchorage, at a place to be announced later: state and local government officials will meet to discuss the state and local relationship for the Coastal Energy Impact Program, including { a review of the draft intrastate allocation process which is currently being prepared. Vie Would) :ncourarj-: that you mark ti'^. A, i ii 12 and l.i di tC' on oul rll.'.11:Y and plan, if possible, to attend these very informative meetings in Anchorage. As in the past, our staff member, Chuck Cohen, will plan to attend these meetings to provide us with technical assistance. Also, Joeilyn Murphy, Dick Langois, and three other representatives of the federal CZM office will be in attendance. Scott Goldsmith and Toni Morchoua^ of the Institute of Social and Economic Research of the University of Alaska will be available to m^et with us on the draft intrastate allocation process. A WA Included with this, is a letter addressed to Governor Hammond explaining how the federal government has computed proposed allotments to the State of Alaska. As other Information which wi I I be pertinent to the Apri 1 12 and 13 meeting be- comes available we will mail It to you. We look forward to seeing you In Anchorage on April 12 and 13. Sincerg V, Pa mer McCarter, Direchor Local Government Assistance VUwr"�-Vj i Kevin Waring, Directo Community Planning Division Glenn Akins, Coordinator Alaska Coastal Management Program cc: Don Berry, Alaska Municipal League Chuck Cohen, Washington, D.C. MCC/PC Enclosure W1 f UNITED BTATEB DEPARTMENT OF COMMERCE Nrtienal Oceanic and Atmospheric Administration dRockvile. Mand 2085D2 ,I • M . Honorable Jay S. Iiammoad Governor of Alaska Juneau, Alaska 99811 Dear Governor mond: I am writing to follow up on my letter of March 2, 1977. Enclosed is a package of materials setting forth the data and infor- mation that the Office of Coastal Zone Management (OCZM) will use In making allotments of funds under the Coastal Energy impact Program (CEIP). This package takes the following form. 1. Allotment data and information for pianninA arants under section 308(c),. ° A technical paper describing the allotment formula and data sources. ° A listing of all the new or expanded energy facilities expected to affect the coastal zone of your state and on which the planning allotment will be based, along with the parameters appropriate to your state that will be used in the allotment formula. 2. Allotment data and information for credit assistance under, section 308(d). ° A technical paper describing the allotment formula and data sources. ° A listing of the anticipated new or expanded coastal energy activities in your state upon which the credit assistance allotment will be based, along with a description of the parameters appropriate to your state that will be used in the allotment formula. 3. Allotment data and information for formula Grants under section 308(b). ° A technical paper describing the allotment formula data sources, and the method used to calculate new employment. -i- LM M F f UNITED BTATEB DEPARTMENT OF COMMERCE Nrtienal Oceanic and Atmospheric Administration dRockvile. Mand 2085D2 ,I • M . Honorable Jay S. Iiammoad Governor of Alaska Juneau, Alaska 99811 Dear Governor mond: I am writing to follow up on my letter of March 2, 1977. Enclosed is a package of materials setting forth the data and infor- mation that the Office of Coastal Zone Management (OCZM) will use In making allotments of funds under the Coastal Energy impact Program (CEIP). This package takes the following form. 1. Allotment data and information for pianninA arants under section 308(c),. ° A technical paper describing the allotment formula and data sources. ° A listing of all the new or expanded energy facilities expected to affect the coastal zone of your state and on which the planning allotment will be based, along with the parameters appropriate to your state that will be used in the allotment formula. 2. Allotment data and information for credit assistance under, section 308(d). ° A technical paper describing the allotment formula and data sources. ° A listing of the anticipated new or expanded coastal energy activities in your state upon which the credit assistance allotment will be based, along with a description of the parameters appropriate to your state that will be used in the allotment formula. 3. Allotment data and information for formula Grants under section 308(b). ° A technical paper describing the allotment formula data sources, and the method used to calculate new employment. -i- LM M -2- r�...e.�n.��m��• IIMP, 1 I1 I,A1 A statement of the acres leased and oil and gas produced adjacent to your state as well as the oil and gas f�.et landed in your state during the fiscal year 1976 and the transition quarter; these data were obtained from the Bureau of Land Management and the U.S. Geological Survey in the Department of the Interior. O A statement of the number of individuals resident in your state who.gained new employment in new or expanded outer Continental Shelf energy activity during the fiscal year 1976 and the transition quarter, along with a detailed explanation of how these new employment figures were arrived at. Note that, since "new employment" is defined as employment after the signing of the Act establishing the CEIP (on July 26, 1976), the figures presented here measure new employment for only July through September 30, 1976; however, since the allotment of formula grants is based on relative shares rather than absolute figures the allotment obtained using these data should not vary much from one calculated with new employment measured over a longer period. In future years, of course, new employment will be measured for the entire preceding fiscal year.) We invite your comments and suggestions with regard to this data and ; Information. We are especially interested in any errors that you may find in the numerical values that could affect the allotments and any additional new or expanding energy facilities which you feel should be included in our inventories. Please contact Joellyn K. Murphy, Director of Federal Programs for OCZM, with any suggested changes prior to May 4, 1977. With best personal regards. Sincerely, 0201" CA) Robert W. Knecht Acting Associate Administrator for Coastal Zone Management Enclosures -2- I P March 15, 1977 CEIP TECHNICAL PAPER: THE PLANNING ALLOTMENT Section 308(c) of the Coastal Zone Management Act (the Act) states that: (t)he Secretary shall make grants to any coastal state if the Secretary finds that the coastal zone of such state is being, or is likely to be, significantly affected by the siting, construction, expansion, or operation of new or expended energy facilities. Such grants shalt be used for the study of, and planning for (including, but not limited to, the application of the planning process included in a management program pursuant to section 305(b)(8)), any economic, social, or environmental consequence which has occurred, is occuring, or is likely to occur in such state's coastal zone as a result of the siting, construction. expansion, or operation of such new or expanded energy facilities. The amount of any such grant shall not exceed 80 per centum of the cost of such study and planning. OCZM, with authority delegated from the Secretary of Commerce, thus has a high degree of discretion as to the manner in which these grants will be made. OCZM has chosen to allot by formula the funds available for the purposes of section 308(c) among eligible coastal states. Formulas now used by Federal agencies to allot planning assistance are simple and based on data that are very easy to obtain. Section 305 coastal zone management program development grants, for example, are based on two equally weighted factors -- miles of coastline and population in coastal counties. The formula the Office of Coastal Zone Management (OCZM) proposes to use in allotting planning assistance under section 308(c) of the Act is also simple, but somewhat more detailed and explicit. It has two parts: I. Fifteen percent (15t) of the money available in a fiscal -3- .....fir_ t 4 Page Two year will be distributed equally among the eligible coastal states. 2. The remaining eighty-five percent (85%) will be divided 1 among the eligible coastal states in proportion to the planning -need equivalencies of each state as calculated by OCZM. HOW ENERGY FACILITY INVENTORY PLANNING -NEED EQUIVALENCIES ARE CALCULATED To determine each state's planning -need equivalency (PNE), OCZM compiles a list or "inventory" of those new or expanded energy facilities expected to affect the state's coastal zone and to motivate planning by the state or its political subdivisions. The facilities on this inventory are called eligible energy facilities. As expressed in the October 22, 1976 proposed regulations and i the January 5, 1977 interim -final regulations, OCZM had intended to make this planning inventory a yearly listing, that is, a given energy facility would be contained on only one yearly list; each yearly in- 1 a ventory would contain an entirely different set of facilities from the inventories of the previous or succeeding years. R OCZM has since modified this concept, turning the planning -need ' equivalency into what might be called a planning -need index. Once an eligible energy facility Joins the inventory, it will not be removed ' until it has been completed or it becomes clear that the facility will { not be built in the foreseeable future. As new energy facilities come on the horizon, they will be added to the list, making the inventory, and the PNE's calculated from the inventory, a measure of the relative t level of ongoing planning -need in the various states. This approach -a- 4 F a 3 i 1 Page Three i I avoids the "bunching" problem: since the allotment is relative, a z j state that had many facilities joining the inventory during a year in which there were also many facilities in other states would be granted a smaller allotment than if there were few facilities in other states. The index approach spreads planning -need more evenly over time and eliminates this bunching problem. FACILITY PARAMETERS AND PLANNING -NEED FACTORS Each eligible energy facility will have a number of characteristics that can be used to calculate a planning -need factor (PNF) associated with that facility. The sum of the planning -need factors for all facilities in a state will be the state's planning -need equivalency. A state's PNE divided by the sum of the PNE's for all the states determines the fraction of the "85 percent" moneys that will go to that state. There are four characteristics of eligible energy facilities that -OCZM uses in computing the planning -need factor of a particular facility: . the employment of the facility; . environmental considerations; ` . public safety considerations; and . regional differences in the cost of planning. (In the October 22 proposed regulations, OCZM based the planning -need j factor solely on employment, the simplest characteristic of a facility to quantity. However, as a result of numerous comments, OCZM added the last three parameters to more accurately reflect the relative need for planning assistance required by different types of facilities in different regions.) , r ` 1 1. i; f IV- r - -- r 7 Page Four r The conceptual formula which relates these parameters is as i follows: r Planning -Need Factor = Employment x Environmental and Safety Considerations x z Regional Cost Differences The employment term will simply be the sum of the Peak Construction Employment (PCE) and the Peak Operating Employment (POE). This has the effect of weighting operating and construction employ- ment equally. The rationalefor this is that while substantial planning is required to accommodate permanent growth, just as much planning may be required to accommodate the influx, and then outflow, of temporary population. (See Appendix A for a detailed explanation of the employ- ment parameter). Techniques for accurately quantifying environmental and safety considerations, to the extent that they have been developed, are quite complicated and not amendable to incorporation into a simple allotment model. However, it is possible to classify facilities into a few simple categories of relative impact. After carefully evaluating the cost effectiveness of using more sophisticated techniques, OCZM decided upon the following method to "quantify" environmental and safety con- siderations. A numerical ranking for environmental considerations (N) and safety considerations (S) is assigned on the basis of the relevant characteristics of a type of facility. A numerical ranking for density (PD) is assigned on the basis of proposed facility site. For each of .6- r, } Page Five i these three terms (N, S, and PD), a ranking of low will be assigned a value of one, "medium" a value of two, and "high" a value of three. The value of the three terms will be added, so the factor for environ- mental and safety considerations can vary between three and nine. (See A endixes B and C for more d tailed ex la ati ) pp e p n on. For example, Environment Safety Population Facility and Site (N) (S) Densitv Sum LNG plant in 1 3 2 6 medium density area Pipelines in remote 2 1 1 4 area Nuclear plant is near 3 3 3 9 high density area The planning -cost differential (PCD) is derived from data on the average salary of professional planners in planning agencies throughout the U.S. The data is taken from an annual American Society of Planning Officials survey of planning agencies. PCD is expressed as an index -- the lowest region is given the value 1.0 and higher regions receive proportionally higher values. (See Appendix D for detailed explanation). Formula for a facility's planninq-Need Factor PNF - (PCE + POE) x (N + S + PO) x PCO Formula for a State's Planninq-Need Equivalency R PNFstate = (PNFf) Irl Where F = the number of facilities in state. -7- M1 Page Six Formula for a State's allotment of 308(c) assistance { PNE Allotment = state x.85($available) state pNE all states +.15 �S available) of eligible coastal states and territories STATE COMMENTS Before each annual allotment, each eligible coastal state and territory will be given the energy facility inventory and all data and information used to calculate its planning -need factors. The states will have 45 days to comment;and OCZM will revise the inventory, data, and information as necessary based on these comments. -8- Page Seven APPENDIX A: EMPLOYMENT PARAMETER Methodoloqy Employment at an energy facility follows a rather predictable pattern, climbing rapidly during the construction phase until the peak construction employment (PCF) is reached, and then falling until con- struction has been completed and employment has leveled off to the peak operating employment (POE). The assumptions used to evaluate the relative planning -need for different employment curves are as follows: 1. Planning -need will be proportional to the number of employees; 2. Planning -need will be inversely proportional to the length of time until the peak employment is reached; 3. Planning -need will be proportional to the rate at which employment grows and/or declines. A number of alternative formulas for calculating planning -need was developed and their predictive capabilities were evaluated against these assumptions. Even though some of the formulas were rather sophisticated and factored in growth rates or assigned different weights to operating and construction employment, analysis showed that the simple sum of peak construction employment and peak operating employment is as effective as even the best of the more complex formulas. This is because most employment curves have approximately the same shape, differing mainly in the values for the peak construction and operating employment, and a formula which incorporates these two terms will give satisfactory results. -9- Page Eight Initially, it was decided to use generic numbers for employment data. That is, for a given type of facility, with a particular capacity, there would be a standardized employment value based on historical data and industry averages. Since it was frequently possible to get actual values for each facility, however, generic employment data are used only when actual values cannot be obtained. Sources Employment data are obtained from a facility's Environmental Impact Statement (EIS), when one exists, and through direct communication with the project or construction managers when there is no EIS. Generic data are obtained primarily from industry and government studies. -10- l s F Page Ni rte r - APPENDIX B. ENVIRONMENTAL AND SAFETY CHARACTERISTICS ti l Safety and environmental characteristics are quantified on a scale i of one to three -- "low," "medium," and "high." This quantification is necessarily subjective, though not necessarily less meaningful. The attached table displays a list of energy facility categories along with the values for N and S attributed by OCZM staff to each of the facility types. The facilities in this table generally fell clearly and discretely into one of the three characterizations. The allotment is not particularly sensitive to these parameters; but, as with all allotment data, OCZM will seriously consider revising values of N and S if there are compelling arguments and/or evidence to warrant revision. -11- I M Page Ten _ r- --- - - ---- - Generic Environmental and Safety Factors for Various Facilities (N) (S) Environment Safety 1 OCS Lease Sale High Low -12- A (includes both exploration and development) 2 OCS Related Onshore Facilities a Drilling rig fabrication yards Low Low b Platform fabrication yards Low Low c Onshore support bases Low Low d Other - - 3 Refineries a Refinery facilities Medium Low b Associated tank storage Medium Medium c Other - - 4 Onshore Oil/Gas Water Separation Facilities Low Low 5 Gas Processing and Treatment Plants Low Low 6 Oil and Gas Storage Facilities a Oil Tank storage Medium Medium b Salt dome storage Low Low c Gas tank storage Low Medium d Other - - 7 Transportation and Transfer Facilities a Major oil pipelines Medium Low b Major gas pipelines Medium Low c Other pipelines Medium Low d Oil gathering lines Medium Low e Gas gathering lines Medium Low f Landfall sites Low Low g Pipecoating yards Low Low h Pipeline fabrication yards Low Low i Barges Medium Low j Deepwater terminals Medium Low k Other marine terminals Medium Low 1 Other - - -12- A Page Eleven 8 LNG Operations a Liquefaction b Regasification c Storage facilities - d Transportation e Terminals f Other 9 Coal Handling a Storage b Port facilities c Slurry pipelines d Other 10 Electric Generating Plants a Fossil fuel b Nuclear c Hydroelectric d Geothermal e Solid Waste f Direct Solar Energy g Wind power h Ocean Thermal gradients I Biomass fuel j Tidal or wave power k Transmission lines 1 Associated facilities m Other ` 11 Nuclear Processing a Treatment b Transportation c Disposal d Reprocessing e Other 12 Miscellaneous a Geopressurized gas i b Solid waste fuel conversion c Other -13- Low Low Low Low Low Low Low Low Medium High Medium Low Low Low Low Low Low Low Low Low Medium Medium High Medium - Low Low High High High High High Low Low Low Low High Low Low Low Low Low Low Low Low Low Low High High High High Low Low / w i fire Page Twel ve APPENDIX C: POPULATION DENSITY Three types (categories) of population density levels distinguished. The first category is urban areas, those wi population density greater than 1000 people per square mile areas have the highest relative need for planning because ( facilities expose a considerable number of people to risk a land uses are highly competitive. The second category of population density level might the urban fringe, those areas with a population density bet and 1000 people per square mile. The third category of population density level is the areas, those with a population density less than 200 people mile. Methodol oqX The most easily obtainable population density data are those of the Bureau of the Census, aggregated by county. This source, however, has limited usefulness because of the high potential for distorted results. (For example, a large SMSA in a basically rural county could make the county appear to be a moderately high density area.) A better source for population densities is the Site Population Factors (SPF) was developed several years ago by the then Atomic Energy Commission. The SPF is the calculation of population density within a twenty mile radius of a site, weighting population close to the facility higher than distant population, because of greater exposure to risk. -14- y �k I i� ;4 a ,i i { I / w i fire Page Twel ve APPENDIX C: POPULATION DENSITY Three types (categories) of population density levels distinguished. The first category is urban areas, those wi population density greater than 1000 people per square mile areas have the highest relative need for planning because ( facilities expose a considerable number of people to risk a land uses are highly competitive. The second category of population density level might the urban fringe, those areas with a population density bet and 1000 people per square mile. The third category of population density level is the areas, those with a population density less than 200 people mile. Methodol oqX The most easily obtainable population density data are those of the Bureau of the Census, aggregated by county. This source, however, has limited usefulness because of the high potential for distorted results. (For example, a large SMSA in a basically rural county could make the county appear to be a moderately high density area.) A better source for population densities is the Site Population Factors (SPF) was developed several years ago by the then Atomic Energy Commission. The SPF is the calculation of population density within a twenty mile radius of a site, weighting population close to the facility higher than distant population, because of greater exposure to risk. -14- __�.��. - _--- --- ■M■M7 III i _ :...,_, ... L.. 19 Page Thirteen An SPF of 1.0 is equivalent to a uniformly distributed population of 1000 persons per square mile (p/sm) surrounding the site for a distance of twenty miles. An SPF of 0.2 is equivalent to a uniformly distributed population of 200 p/sm surrounding the site for a distance of twenty miles. The AEC has calculated SPF's for all sites in contiguous U. S. OCZM has used these SPF's for all sites except those in Alaska, Hawaii and the U. S. Territories, where county population density data from the census was used. -15- ! 1 I _i E I!i I� f __�.��. - _--- --- ■M■M7 III i _ :...,_, ... L.. 19 Page Thirteen An SPF of 1.0 is equivalent to a uniformly distributed population of 1000 persons per square mile (p/sm) surrounding the site for a distance of twenty miles. An SPF of 0.2 is equivalent to a uniformly distributed population of 200 p/sm surrounding the site for a distance of twenty miles. The AEC has calculated SPF's for all sites in contiguous U. S. OCZM has used these SPF's for all sites except those in Alaska, Hawaii and the U. S. Territories, where county population density data from the census was used. -15- .w _. .� S4 IiuL�-3 �dii6-.Ey - _ _- _ __ _-d..33.:-iY":..i• :3ti=?x•�-9--�t a..`....:�=-c`�e�MYs+.. .. _ _ __ -----_"l.i _._._. _'. _ I ..,-� Page Fourteen APPENDIX D: PLANNING -COST DIFFERENTIAL Data Source Every year, the American Society of Planning Officials (ASPO) publishes a report summarizing the results of a survey of the salaries of planners in the United States. (ASPO Planning Advisory Service Report 306, Expenditures, Staff and Salaries of Planning Agencies -- 1975). This survey was sent to 1157 city, county, joint, metropolitan, regional and state planning agencies. The data from which the index of planning cost differentials was calculated included median salaries and the number of planners disaggregated by region, education, and years of experience. Region PCD New England (Connecticut, Maine, 1.00 Massachusetts, New Hampshire, Rhode Island) Mid -Atlantic (New Jersey, New York, 1.03 Pennsylvania) South Atlantic (Delaware, Florida, 1.16 Georgia, Maryland, North Carolina, Puerto Rico, South Carolina, Virgina Virgin Islands) East South Central (Alabama, 1.01 Mississippi) East North Central (Illinois, Indiana, 1.13 Michigan, Ohio, Wisconsin) West South Central (Louisiana, Texas) 1.00 West North Central (Minnesota) 1.11 Pacific (Alaska, American Samoa, 1.17 California, Guam, Hawaii, Oregon, Washington) -16- t CEIP — SECTION 308(C) PLANNING INVENTORY MARCH 16, 1977 i STATE: ALASKA i COUNTY: ACTIVITY: MAJOR OIL PIPELINE NAME: TRANS—ALASKA PIPELINE SYSTEM j LOCATION: PRUDHOE BAY TO VALDEZ OPERATOR: ALYESKA PIPELINE SERVICE COTOANY • FACILITY g4MV CAPACITY: INITIAL OPERATING DATE: CONSTRUCTION START DATE: CONSTRUCTION END DATE: ENVIRONMENTAL IMPACT STATEMENT ? EIS STATUSs FEDERAL PERMIT APPLIED FOR ? DESCRIPTION: FEDERAL PERMIT OBTAINED ? DESCRIPTION: STATE PERMIT APPLIED FOR ? DESCRIPTION: STATE PERMIT OBTAINED ? DESCRIPTIONS PEAK CONSTRUCTION EMPLOYMENT: PEAK OPERATING EMPLOYMENT: ENVIRONMENT FACTOR: SAFETY FACTOR: POPULTATION DENSITY CODE: PLANNING COST DIFFERENTIAL: 48—INCH 1977 400 130 2 1 1 1.17 1 f r. is CEIP — SECTION 308(C) PLANNING INVENTORY MARCH 16, 1977 i STATE: ALASKA i COUNTY: ACTIVITY: MAJOR OIL PIPELINE NAME: TRANS—ALASKA PIPELINE SYSTEM j LOCATION: PRUDHOE BAY TO VALDEZ OPERATOR: ALYESKA PIPELINE SERVICE COTOANY • FACILITY g4MV CAPACITY: INITIAL OPERATING DATE: CONSTRUCTION START DATE: CONSTRUCTION END DATE: ENVIRONMENTAL IMPACT STATEMENT ? EIS STATUSs FEDERAL PERMIT APPLIED FOR ? DESCRIPTION: FEDERAL PERMIT OBTAINED ? DESCRIPTION: STATE PERMIT APPLIED FOR ? DESCRIPTION: STATE PERMIT OBTAINED ? DESCRIPTIONS PEAK CONSTRUCTION EMPLOYMENT: PEAK OPERATING EMPLOYMENT: ENVIRONMENT FACTOR: SAFETY FACTOR: POPULTATION DENSITY CODE: PLANNING COST DIFFERENTIAL: 48—INCH 1977 400 130 2 1 1 1.17 i 1 f r. i 1 r. � J a 1 r a CEIP — SECTION 308(C) PLANNING INVENTORY ?; MARCH 16, 1977 STATE: ALASKA COUNTY: i; ACTIVITY: TRANSPORTATION If NAME: ALCAN PIPELINE SYSTEM LOCATION: PRUDHOE BAY TO YUKON BORDER OPERATOR: ALCAN PIPELINE COMPANY FACILITY TYPE: MAJOR GAS PIPELINE CAPACITY: INITIAL OPERATING DATE: CONSTRUCTION START DATE: i CONSTRUCTION END DATE: j ENVIRONMENTAL IMPACT STATEMENT ? I EIS STATUS: FEDERAL PERMIT APPLIED FOR ? DESCRIPTION: FEDERAL PERMIT OBTAINED ? DESCRIPTION: STATE PERMIT APPLIED FOR ? DESCRIPTION: STAT$ PERMIT OBTAINED ? DESCRIPTION: PEAK CONSTRUCTION EMPLOYMENT: PEAK OPERATING EMPLOYMENT: ENVIRONMENT FACTORS SAFETY FACTORS POPULTATION DENSITY CODE: PLANNING COST DIFFERENTIAL: E YES FINAL YES FPC DOCKET CP 76-433 0 965 18 2 1 1 1.17 -- ---Am 0 I n j� I CEIP — SECTION 308(C) PLANNING INVENTORY �j MARCH 16, 1977 STATE: ALASKA i COUNTY: ACTIVITY: TRANSPORTATION NAHEs EL PASO ALASKA NATURAL. GAS SYSTEH LOCATION: NORTHSLOPE TO POINT GRAVINA - OPERATOR: EL PASO ALASKA COMPANY ' FACILITY TYPE: MAJOR GAS PIPELINE CAPACITY: 42—INCH INITIAL OPERATING DATE: CONSTRUCTION START DATE: CONSTRUCTION END DATE: ENVIRONMENTAL IMPACT STATEMENT ? EIS STATUS: FEDERAL PERMIT APPLIED FOR ? DESCRIPTIONS FEDERAL PERMIT OBTAINED ? DESCRIPTION: STATE PERMIT APPLIED FOR ? DESCRIPTION: STATE PERMIT OBTAINED ? DESCRIPTiONs PEAK CONSTRUCTION EMPLOYMENT: PEAK OPERATING EMPLOYMENT: ENVIRONMENT FACTOR: YES FINAL YES FPC DOCKET CP 75-96 2,925 624 2 SAFETY FACTOR: 1 POPULTATION DENSITY CODES 1 ` PLANNING COST DIFFERENTIAL: 1.17 I( I i ' I 1 TRANSPORTATION ALASKAN ARCTIC GAS PIPELINE COMPANY GAS PIPELINE IAL N DOCKER CP 74-239 .17 kill CEIP SECTION 308(C) PLANNING INVENTORY MARCH 16, 1977 STATE: ALASKA COUNTY: AG7111VITY: NAME: ALASKAN ARCTIC NATURAL GAS SYSTEM LOCATION: P DHOE BAY TO CANADIAN BORDER OPERATOR: FACILITY TYPE: MAJOR CAPACITY: 195 MILES/48-INCH INITIAL OPERATING DATE: CONSTRUCTION START DATE: CONSTRUCTION END DATE: ENVIRONMENTAL IMPACT STATEMENT ? EIS STATUS: FEDERAL PERMIT APPLIED FOR ? DESCRIPTION: FEDERAL PERMIT OBTAINED ? DESCRIPTION: STATE PERMIT APPLIED FOR ? DESCRIPTION: STATE PERMIT OBTAINED ? DESCRIPTIONt PEAK CONSTRUCTION EMPLOYMENT: PEAK OPERATING EMPLOYMENT: ENVIRONMENT FACTOR: SAFETY FACTOR: ► POPULTATION DENSITY CODE: PLANNING COST DIFFERENTIAL: YES Pi YE FPS C 68 32 9 2 March 15, 1977 t Coastal Energy Impact Program (CEIP) Technical Paper: The Credit Assistance Allotment. The allotment. The loans and guarantees provided by the CEIP are allotted by a formula, outlined in section 306(e)(1) of the Coastal Zone Management Act (the Act), that is based on the following factors: (A) The number of additional individuals who are expected to become employed in new or expanded coastal energy activity, and the related new population, who reside in the respective coastal states. (6) The standardized unit costs (as determined by the Secretary by rule), in the relevant regions of such states, for new or improved public facilities and public services which are required as a result of such expected employment and the related new population. This allotment of CEIP credit assistance is thus forward looking: it attempts to anticipate needs. Each year, OCZM compiles a list or "inventory" of the new or expanded coastal energy activities likely to take place in or affect the coastal zones of each of the coastal states and territories. A coastal energy activity is limited by the Act to the following kinds of energy activity: • OCS energy activity; • the transportation, conversion, treatment, transfer, or storage of liquified natural gas (LIIG); and • the transportation, transfer, or storage of coal, oil, or natural gas. -21- Y- -- _— -4 Page Two These activities also must have technical requirements necessitating their location in or near the coastal zone. The most frequent criterion for the inclusion of a planned new or expanded coastal energy activity on the inventory is that the activity has obtained a major Federal or state license or permit (or, in the case of OCS activity, be a part of anticipated exploration or development attendant on a lease sale or the filing of a development plan). Nevertheless, an energy activity that does not meet this criterion can be included on the 'list if it is clear that the activity has a high probability of materializing in the near future regardless of its formal permit status. The next step in the allotment is to estimate, for each activity on the list, the number of new workers and the related new population who will likely reside in the coastal states affected by that activity. This is done in two parts. First, the expected new direct employment is estimated for each energy activity (both construction and operating workers); then, a formula (described below) is used to derive the "related new population," i.e. the families of new employees as well as the "induced" workers or secondary employment (those who move into an area to support the direct workers or primary employment) and their families. The process is as follows. OCZM begins with an estimate of the construction work force (CE) in the year of peak construction activity and an estimate of the operating work force (OE) in the year of maximum operating force employment. These estimates are normally obtained directly from the energy companies sponsoring or participating in the energy activity or from the environmental impact statement (EIS) prepared for the energy activity when direct estimates are not available. -22- i:� �""---,==.�=-=ix:•=:'min-� -� �-, I 7 Page Three I E " text, OCZM applies the following formula to determine the total new i population generated in each coastal state by the energy activity's "temporary workforce" (CE - OE) and "permanent workforce" (OE). The "temporary" employment is calculated as the difference between the peak construction workforce and the peak operating workforce; figure i makes this clear. Total "temporary" population = (CE - OE) x CH x CH Total "permanent" population OE x OH x ON LM I 11 The letters OH, CH, CM, OM represent "multipliers," which translate direct employment into total population. (The derivation of these multipliers is discussed in detail below.) In order to calculate from these population estimates the "need" each state will have for new or improved public facilities and public services, the formula must also include the second factor mandated by i section 308(e)(1): the standardized unit costs per capita of providing f public facilities and services. The need factor associated with each facility on the inventory list will thus be: Need Factor a OU x OF x OH x OM + CU x (CE - OE) x CH x CM OU represents the standardized unit costs of providing public facilities and services for operating (permanent) personnel and related population. CU represents the standardized unit costs of providing facilities and services for temporary personnel and related population. If a new or expanded coastal energy activity affects more than one state, the need factor is calculated separately for each state. The sum of all the need factors associated with all the coastal energy activities affecting a given state constitutes that state's total need factor -- it's LM I 11 f Page Four i Figure 1: illustration of "temporary" and " _ gpermanent employment for a typical coastal energy activity. E employment CE -24- time E -OE w E i I f I-IC-11 I I -. L.._II I I I Ilk N V— } Page Five need for new or improved public facilities and services because of the new or expanded coastal energy activities identified in the inventory. 1 If the amount appropriated by Congress in a given year for the credit assistance provisions of the CEIP is more than the total need calculated for all the coastal states, then the state need factors are absolute allocators of the credit assistance -- the state receives an amount equal to its need factor. If the Congress appropriates less than the sum of all the state need factors, then there is not enough credit assistance to go around, and the state need factors become relative allocators each state receives a share in proportion to its need factor. Now the multipliers are calculated. Consider, for a moment, the multipliers for the operating work force and related new population. (The calculation is identical for the construction force; only the variables are different, i.e. ON and OM for operations phase and CH and CM for construction phase.) H is the size of the average household of those new workers who bring their families with them. S is the service ratio, the number of workers needed in service industries (stores, restaurants, etc.) per capita. The multiplier ON will be the following weighted average. ON = OR + (1 - OR) x H, where OR is the fraction of new energy activity employees who either: Is are already local residents; e live in another state and commute to work; or Is are new residents who do not bring families. This means that the average household size for all new workers associated with a new or expanded coastal energy activity is a weighting of the number -25- '"� IN Page Six i of workers who have a household size of one (the worker himself) and the number of workers who bring families times the size of the resulting household (H). 1' The multiplier OM determines the number of "induced workers" who are needed to support each new direct energy employee. Factoring in these induced workers and their families, the total new population is OE x ON + WE x OH) x S) x ON = OE x ON x (1 + ON x S). But, it can be argued, the "induced population" itself induces new population which must be factored in. This would mean that new population = OE x ON + ((OE x OH) x S) x ON + (((OE x ON) x S x OH) x OH) x S = OE x OH x (1 + (ON x S) + (OH x S)2). Similarly, one could argue that the population induced by the induced population itself induces population, and so on ad infinitum. Carrying this logic through leads to the conclusion that new population = OE x ON x (1 + (ON x S) + (OH x S)2 + (OH x S)3 +...) Fortunately, for the values of ON and S we will be using, this infinite sum is equal mathematically to the simpler expression, new population = OE x _.pH1 1 - H x S =OExONx011 i That 1 s, ON 1 1-ONxS The calculation is similar for the temporary workers. New population (temporary) _ (CE - OE) x CH x C14, where CH = CR + (1 - CR) x H, CR = fraction of temporary workers who do not bring families with them, and CM = 1 t l - CH S -26- k --- T- 1 Page Seven How the parameters are estimated. The values these multipliers take on for various states and various coastal energy activities depend on the values assigned to the basic parameters OR, CR, S, and H. The parameters OR and CR are estimated after consulting relevant studies and the energy companies involved in the specific coastal energy activities. The parameter H is derived on a state -by -state basis from Internal Revenue Service data (U.S. Department of the Treasury, Statistics of Real Income 1972 -- Individual Income Tax Returns, Washington, D.C., 1976, pp. 228-234) as described in the following Table 1. The average household size for coastal states derived in this manner is 2.58. Average household size for each coastal state calculated in this manner is given in Table 2 column 1. The parameter S is calculated in the following manner. First, ` S.I.C. Codes (Office of Management and Budget, Standard Industrial Classification Manual, U.S.G.P.O., Washington, D.C., 1912) for service and retail job function categories were isolated. These include codes 52 through 59 (Retail Trade), 70 through 81 (private service jobs), and 92 through 93 (state and local government). Second, for each state, the total employment in each of these categories is found by consulting U.S. Department of Labor statistics for 1972 (U.S. Department of Labor, Employment and Earninqs, January 1972, U.S.G.P.O., 1973). Third, these figures for total service employment in each state are divided by the total state population (source: U.S. Census). The resulting fraction is a statewide average of the number of jobs in these support categories per capita. -27- IL F __ i Page Eight Table 1 Calculation of Mean Size of Taxpaying Unit (1972 data) (Individual state U.S. example) (millions) Total members of taxpayingu, nits jJ + Taxpayer o;cwaptions p. 232(4)............. 120.934 1.848 - Revenue sharing adjustment, p. 234(29)..... 4.982 0.069 + Taxpayers' dependent exemptions, p. 233(12) 76.632 1.340 A 192.584 3.119 Number of taxpaying units J + Taxpayer exemptions, p. 232(4) ............. 120.934 1.848 • Joint returns. P. 23402)... ... 43.113 0.708 - 13 husband -wife separate returns, p. 228(1). 1.200 0.015 ` - Revenue sharing adjustment, p. 234(29)..... 4.982 0.069 B 74.758 1.069 A/B = Mean size of taxpaying unit....... 2.58 2.95 * Page and column numbers (e.g., p. xxx(yy). xxx = page number; yy column number) refer to Statistics of Income 1972 --Individual Income Tax Returns. 1 The total members of taxpaying units: All claimed exemptions (taxpayers and their dependents) less the revenue sharing adjustment. This later item is the number of persons claimed as exemptions but who filed separately or who did not live in the home of the taxpayer. (See line 34, Form 1040(1972), page 2). J Taxpayer exemptions include husband and wife in joint returns and in returns in which husband and wife file separately, therefore, the number of joint returns and one-half the number of husband -wife separate returns must be subtracted from the number of taxpayer exemptions. In addition, we do not want to include those who claim themselves as deductions and are also claimed by their family -- so the revenue sharing adjustment must be subtracted. Actually, the revenue sharing adjustment is too large by the number of persons claimed as exemptions and not living at home who do not file returns and claim their own exemption. This error will tend to bias the estimate of "mean size of taxpaying unit" upward. -28- V i Page hb.ne STATE ALABA14A ALASZ..A CALIFORNIA codUECTICUT DELAWARS FLORIDA GEORGIA HAWAII ILLIIIOIS I11DZANA LOUISIANA IIAINE MARYLAND MASSACHUSETTS NIClUGAY 14I11.7ESOTA I.1roszSSIPPI !JEW HAMPSHIRE list/ JERSEY !JEW YORK NORTH CAROLINA OHIO OREGON PE1111SYLVARIA RHODE ISLAND SOUTH CAROLINA TEXAS VIRGIAIA :IASiiraGTOi1 WI;CONSIN VIRGIB ISLANDS TABLE 2 HOUSEHOLD SIZE 2.7891 2.9469 2.6718 2.6671 2.7911 2.6160 2.7176 2.6058 2.6813 2.8393 2.9514 2.9834 2.6625 2.5105 2.7811 2.7283 2.9782 2.6766 2.6207 2.6037 2.5901 2.6796 2.6053 2.6268 2.6027 2.6539 2.8001 2.6195 2.7864 2.7243 3.3000 -29- .-�.-.-,.-__Y316��iYl�L�I.�IdI SERVICE RATIO .1133 .1354 .1536 .1422 .1673 .1631 .1337 .1833 .1405 .1288 .1258 .1336 .1550 .1623 .1302 .1544 .1098 .1387 .1363 .1574 .1174 .1371 .1475 .1315 .1423 .1118 .1398 .1327 .1423 .1417 I .1200 I I a t I Page Ten The average service ratio for the coastal states calculated using this method is .1403 (i.e. for every 100 people, 14 are employed in the service sector, as OCZM has defined it for the purpose of calculating allotments). The service ratio for each coastal state calculated using this method is given in Table 2 column 2. How the standardized unit costs are calculated. A. New Permanent Population The standardized unit costs for new permanent (operating) population (OU) for each coastal state include capital and operating costs for public facilities and services. These costs are for: open space and recreation, education, public safety, transportation, utilities, government administration, and health care. Of these, education comprises 40% of the total capital costs and 56% of the total operating costs. Actual dollar value costs in (1973 dollars) for these facilities and services are given in the report of the President's Council on Environmental Quality entitled The Costs of Sprawl. This report contains a detailed cost analysis of different types of development patterns and the costs of providing services for each type. The patterns range from low density urban sprawl, which typically is the most expensive for which to provide services, to high density planned urbad development which is, in many ways, the least expensive to service. From The Costs of Sprawl the following specific numerical results were derived as shown in Table 3. -30- Page Eleven Table 3 High Density Planned Development Pattern Total Capital and Operating Costs for Facilities and Services (1973 dollars) Capital Costs. The national total per capita capital cost figure of $3029 can be converted to 1976 dollars by using the Department of Commerce composite cost index (U.S. Department of Commerce, Construction Review, October 1976). For 1976 the composite cost index is 33% higher then for 1973 (196.5 in 1976; 147.8 in 1973). Converting, then, to 1976 dollars: $3,029 x 1.33 4 $4,028. -31- 14 A- Capital Capital Cost Operating Operating Cost Type Cost Per Capita Cost Per Capita Open space/recreation $ 2,560,000 $ 78 $----- $--- Education $45,382,000 $1,375 $9,462 $292 Public Safety $ 1,749,000 $ 53 $1,090 $ 33 Transportation $22,862,000 $ 692 $ 209 $ 6 Utilities $22,432,000 $ 680 $6,013 $182 Government Admin. $ 551,000 $ 17 $----- $--- Health Care $ 4,431,000 $ 134 $1,936 $ 59 Total $3,029 $572 Capital Costs. The national total per capita capital cost figure of $3029 can be converted to 1976 dollars by using the Department of Commerce composite cost index (U.S. Department of Commerce, Construction Review, October 1976). For 1976 the composite cost index is 33% higher then for 1973 (196.5 in 1976; 147.8 in 1973). Converting, then, to 1976 dollars: $3,029 x 1.33 4 $4,028. -31- 14 A- T_ r -- - -- -7 Page Twelve This national total capital cost of $4,028 per capita can be i "localized" to the state level by using multipliers fro,j the Marshall Valuation f Service (Marshalland Swift Publication Company, January 1977). Applying the Marshall Valuation Service multiplier to the national figure yields the state figure. For example, California has a Marshall Valuation Service multiplier of 1.12. Therefore, California's total capital cost per capita is $4,028 x 1.12 - $4,511. (See Table 5 column 1 for state multipliers derived from Marshall's.) Operatinq Costs. The national operating cost per capita of $572 can be converted both to state level by region and to 1976 dollars by Consumer Price Indices for 1976. (U.S. Department of Labor, Monthly Labor Review.) These indices by region for 1976 compared to 1973 are presented in Table 4. I Table 4 Consumer Price Indices Region 1973 1976 % change multipliers Northeastern U.S. 136.7 177.9 5 'I 26. 1.265 North Central U.S. 131.5 167.1 27.0 1.270 Southern U.S. 133.0 172.5 29.7 1.297 Western U.S. 129.3 166.8 29.0 1.290 -32- t - - i Page Thirteen Simple multiplication of the appropriate Consumer Price Index multiplier for each involved state, depending upon the state's regional location, yields the 1976 operating cost for that state. Continuing the example Of California: $572 x 1.25 - •$738 The standardized unit cost for new permanent population can be obtained by summing capital and operating costs. For California, $4,511 + $738 = $5249. Standardized unit costs for all coastal states are given in Table 5. B. New Temporary Population. The standardized unit costs for new temporary population are very difficult to estimate. Since education is the single largest cost to the community, it was proposed that reasonable standardized unit cost for temporary needs could be obtained from the ratio of the cost of a temporary _. classroom to the cost of a comparable permanent classroom. Using $25 per square foot, which is the current cost of a single relocatable classroom, and $42 per square foot, which is the current cost of a permanent building, this ratio turns out to be $25/42 - 605. Thus, standardized unit costs for new temporary population are estimated to be 60% of those for new permanent population. t r .33- -Page Fourteen ' TABLE 5 Standardized Unit Costs ' --i. i.. -41W .. 1/From Marshall Valuation Service 2/$4,028 Is National Per Capita Capital Cost in 1976 Dollars. 3/$572 Is National Per Capita Operating Cost in 1973 Dollars. -34- I (Based on cost of sprawl 'high density planned' development pattern) State Capital Cost Regional % Change Operating Cost SUC Local $4,028 x (1) CPI's In $572x(1.0+(4) (2) + (5) State Multiplier (1976 $)2 1976 CPI -1973 (1976 $) (1976 ) 1. ALA 0.92 $3,706 172.5 29.7 $742 4,448 2. AK 1.62 6,525 163.3 35.0 772 7,297 3. CAL 1.12 4,511 166.8 29.0 738 5,249 4. CON 1.06 4,270 172.9 26.5 724 4,994 S. DEL 0.94 3,786 172.9 26.5 724 4,510 6. FLA 0.94 3,786 172.5 29.7 742 4,528 7. GA 0.88 3,545 172.5 29.7 742 4,287 8. HAW 1.34 5,398 9. ILL 1.05 4,229 167.1 27.0 726 4,955 10. IND 1.00 4,028 167.1 27.0 726 4,754 11. LA 0.93 3,746 172.5 29.7 742 4,488 12. ME 0.96 3,867 172.9 26.5 724 4,591 13. MD 0.97 3,907 172.9 26.5 724 4,631 14. MAS 1.04 4,189 172.9 26.5 724 4,913 15. MI 1.04 4,189 167.1 27.0 726 4,915 16. MIN 1.02 4,109 167.1 27.0 726 4,835 17. MIS 0.84 3,384 172.5 29.7 742 4,126 18. NH 0.96 3,867 172.9 26.5 724 4,591 19. NJ 1.06 4,270 172.9 26.5 724 4,994 20. NY 1.08 4,350 172.9 26.5 724 5,074 21. NC 0.86 3,464 172.5 29.7 742 4,206 22. OH 1.05 4,229 167.1 27.0 726 4,955 23. ORE 1.02 4,108 166.8 29.0 738 4,846 24. PA 1.03 4,149 172.9 26.5 724 4,873 25. RI 1.02 4,108 172.9 26.5 724 4,832 26. SC 0.83 3,343 172.5 29.7 742 4,085 27. TEX 0.92 3,706 172.5 29.7 742 4,448 28. VA 0.90 3,625 172.5 29.7 742 4,367 29. WA 1.06 4,270 166.8 29.0 738 51008 30. WIS 1.02 4,108 167.1 27.0 726 4,834 1/From Marshall Valuation Service 2/$4,028 Is National Per Capita Capital Cost in 1976 Dollars. 3/$572 Is National Per Capita Operating Cost in 1973 Dollars. -34- I STATE: Alaska LWATIOV: TYPE OF FACILITY: OCS Lease Sale #39 PEAKOIk�STRiICTIO:Y R- PLOP. Wr ((E) : N/A, PEAT.. OPERAT M. D PLOY!►iiu IT (OB): 1600 A%TR4M. IVJSPMLD SIZE (to: 2.9469 SERVICE RATIO (S): .1536 FRACTI(i OF MNSTRUCYIO,%f V.-ORKERS 11110 ARE 0= 07 R,F�SID 'fS, C�k`•A�.TF.Rti, OR BEC%C- NBV RESIDFArfS W. DO AAT num miums (cm: N/A TRICTI(ni OF OPERATING IMMUS WK) ARE (13RM-W PJSID07S, MUMR.3, OR BBM.%'Q: HSI RESIDIdfS BUr DO NOT BRING FAWLiCS (5,q): .7 STA"dDARDIZED WITS COSTS, CMISTRUCfI4?i PAP[lLl1Tlo\l (C[n : AI/A STANDARDIZED WIT COSTS, OPERATING POPIIIATION (OU):. $7297 -35- I i I ALASKA LEASE SALE # 39 i The lease sale of 76 tracts took place in April 1976, To estimate the need factor because of the activities during the exploration phase of lease sale #39, the following assumptions were made. 1. Two exploratory wells will be drilled per tract. 2. Each exploratory rig will drill on the average four exploratory wells per year, 3. The exploration phase will last five years, 4. Seventy percent of the people obtaining employment during the exploration phase of lease sale #39 will be either local residents or commuters. in other words, thirty percent of the workers will become new residents and bring their families. S. A typical exploratory rig has a crew of 140 (70 people on and 70 people off) and it requires 60 additional people in onshore support services including air and marine transportation. a. Calculation of Emolovment and Need Factor The maximum number of exploratory rigs that will be needed per year is given by the formula: (# of tracts leased) (# of wells drilled per tract) (# of wells drilled per exploratory rig) (# of years exploration phase lasts) 76 x 2 7 5 .6 In other words, at most 8 exploratory rigs will be needed annually during the exploration phase. Five oil companies have already identified the following exploratory rigs they are going to use. Rio Name company Date SEDCO.706 Shell April 1976 Ocean Ranger Arco October 1976 Alaskan Star Exxon March 1977 Ocean Bounty Texaco April 1977 Aleutian Key Gulf April 3977 Y -36- t • - � 111111 1111j"..01 U I I I I W�1�11 ,. f I I � I b. Since each exploratory rig employs 200 people, the total number of people obtaining employment because of the eight exploratory rigs will be 1600 (-8x200). i; -37- _..a illll l 1111111111 III �lII'•I, 11111111111111 —11 � iii .nwswwG . V V STATE: Alaska LOCATION: Prudhoe Bay TYPE OF FACILITY: Alyeska Pipeline (Coastal Zone section only) PEAK COMRUCTI0.14 19P1MV1't' (r.E) : 150 PEAL: oFERATING DIPL ru.T MM: 40 A%TR:1.''`°i IIOUSFUDLY) SIZE (10 : 2.9469 SERI'Ia RATIO M: .1354 lit MOM OF CMSTRU MOX WORMS 1110 ARE n.SRRENT RFSIPF,\TS, i�:+�'mus. OR 14EMM h8f RESIDMUS BU, W hOT BRING l-it"IiI.IFS (CR) MAff, IM OF OPERATING 10itdCi?RS 1110 ARF MU PJSIIENTS, ii?-TWERUS, OR BE(VIF. 1\91 PESI.NNTS BUr DQ Wr BI ENG lF1L\!ILtFS (O?t): 7 S17M)ARDIZED WITS ODSTS, 0D.NSTRUMMI P01MAATM ((U): $4378 STANDARDIZED UNIT OOSTS, OPERATIM, POPULATION (OU) : , $7297 STATE: Alaska IACATIOL Valdez TYPE OF FACILITY: pipeline fteminal PEAS CONSTRUCPICIN DFLOY'•+Sss1T (CE) : 250 PEM OPERATING DIPLOITTTP (OF.): 90 M -M --WE IIOUSFMID SIZE (10 : 2.9469 SEWICE RATIO (S): .1354 FRACTION OF OUNSTRUCPION 1MRIMP.S 1%1(0 ARE C.19 NX PESTTWNTS. ro. t,, mus, OR BECO M NE1': RESIDi1TS BU, DO NOT BP.ISG FA%III.IFS (CR) : •9 FRACTION Of OPERATING MR.MRS Min APs": (' 7M -T P,1SIDi:;TS, (3^.furF(LS, OR BFW. F. NBI RFSI118dl'S BUT DO NOT BRING, MUTES (Ori): .7 ST,V.T)ARTIIZF.D UNITS DOSTS, CON15TRUCTIOM POPULATI!?V (C.U) : $4378 STANDARDIZED UNIT COSTS, OPERATING POKUTIM (o!):. $7297 P 'I STATE: Alaska IACATIOL Valdez TYPE OF FACILITY: pipeline fteminal PEAS CONSTRUCPICIN DFLOY'•+Sss1T (CE) : 250 PEM OPERATING DIPLOITTTP (OF.): 90 M -M --WE IIOUSFMID SIZE (10 : 2.9469 SEWICE RATIO (S): .1354 FRACTION OF OUNSTRUCPION 1MRIMP.S 1%1(0 ARE C.19 NX PESTTWNTS. ro. t,, mus, OR BECO M NE1': RESIDi1TS BU, DO NOT BP.ISG FA%III.IFS (CR) : •9 FRACTION Of OPERATING MR.MRS Min APs": (' 7M -T P,1SIDi:;TS, (3^.furF(LS, OR BFW. F. NBI RFSI118dl'S BUT DO NOT BRING, MUTES (Ori): .7 ST,V.T)ARTIIZF.D UNITS DOSTS, CON15TRUCTIOM POPULATI!?V (C.U) : $4378 STANDARDIZED UNIT COSTS, OPERATING POKUTIM (o!):. $7297 P - '-. -- - - -- - - - T - - - - - r :T - -"% March 15, 1)77 CUP technicsi paper: the formularg ant allotment. The formula grants will be allotted according to a formula specified in the statue. Definitions A: total amount of OCS acreage leased by the Federal Government in the immediately preceding fiscal year. Ai: OCS acreage leased by the Federal Government in such fiscal year and that is adjacent to state I. P: total volume of oil and natural gas produced in such year from all of the OCS acreage which is leased by the Federal Government. Pi: volume of oil and natural gas produced in such year from the OCS acreage that is adjacent to state I. L: total volume of oil and natural gas produced from the OCS acreage leased by the Federal Government which is first landed in all of the coastal states during the immediately preceding fiscal year. Li: volume of oil and natural gas produced from the OCS acreage ` teased by the Federal Government which is first landed in state i in such year. E: total number of individuals who obtain new employment because of new or expanded OCS energy activities in such year. Ei: number of individuals who obtain new employment because of new or expanded OCS energy activities in such year and who reside in state I. -40- L1 s•---,- .-- -- The share of the total amount of formula grants appropriated by rt Congress in a given year that will go to state i is given by the formula: Si �i + + ri + 3 �i -41- � •:as.•z r- �.. t. Appendix A: determing the "new employment" factor. i The term "new employment" is not defined in the statue. Some examples will be given here on how OCZM interpreted the legislative history of this term. 1. A worker who moves from an old platform to a new platform that is installed after July 26, 1976 will be considered as a new employee. 2. If a drilling rig is moved onto an already existing platform and the permit to drill is issued after July 26, 1976, the whole drilling crew moving onto the platform will be considered new employees. 3. By contrast, if a mobile exploratory drilling rig is moved on a different OCS tract in the same geographical area, the crew of the rig will not be considered new employees. But, if the exploratory rig moves to another geographical region (e.g., from the OCS of California to the OCS of Louisiana, or from the OCS of the Gulf of Alaska to the OCS of Beaufort Sea), then the crew of the nubile unit will be considered new employment. The statue refers to new employment as that which occurs during the fiscal year previous to the one in which the allotment is made. Since the current allotment is being made for fiscal year 1977, the previous fiscal year (including the transition quarter) started on July 1, 1975 and ended on Ocotber 1, 1976. Because the Coastal Energy Impact Program was signed into law on July 26, 1976, OCZM would have to consider as new employment only that which occured after July 26, 1976 and before October 1, 1976, if the definition of new or expanded OCS energy activity (§931.18 of the regulations) were interpreted strictly. Instead, OCZM considered as "new employment" all employment which occured during July, August, and September of 1976. -42- I A N To estimate the new employment during those three months,OCZM used information from U.S. Geological Survey and from various types of companies engaged in OCS energy activities. The information received from these sources is listed below: -43- T f i z i To estimate the new employment during those three months,OCZM used information from U.S. Geological Survey and from various types of companies engaged in OCS energy activities. The information received from these sources is listed below: -43- f FORMULA GRANT FACTORS STATE: Alaska ACRES LEASED: 409.057 OIL & GAS PRODUCED: 0 OIL & GAS Landed: 0 NEW EMPLOYMENT: 350 mo ., ru 'SIM 1i 111 1 VIII I I I I Alaska The following two mobile exploratory drilling rigs proved in the OCS of the Gulf of Alaska during July, August, and September of 1076. Name of Riq Operator Date Employment SEOCO - 706 Shell August 200 Ocean Ranger Arco September 150 In other words the total new employment in the State of Alaska because of new or expanded OCS energy activities during the previous fiscal year is 350. -45. f .- - r?xr_i I.i !LII. 1 L 08 041LO4 JAYS HAMMOND r' / GOY[pMOA i UEI'AIIT1f1:NT IIK 11111YIEItI'Lr A rr ' ECONOMIC DEV111.019MENT /' 71w11*0oa MACKAY "LUG DIVISION OF ENERGY & POWER DEVELOPMENT 770 DENALI STREET jANCHORAGE. AN 09501 {" March 22, 1977 Dear Community Leader: As you are probably aWd re through our last letter, the Division of Energy and Power Development is sponsoring a volunteer -oriented pro- gram called the "Energy Conservation Advocates". The goal of this program is to involve the people of your community in I identifying your energy needs and what solutions can be found throuqh i i education and application of various energy conservation projects. On Wednesday, (larch 30 at 7:30 pm in the coffee room of the Kenai Bor- I ouqh Office, the Energy Conservation Advocates would like to meet with f you to discuss how the program could help with your energy needs. Topics that will be discussed include: 1) how your community or group can sponsor a workshop on home winterization to teach homeowners how to cut down on fuel loss for next winter and save money; 2) possible projects a involving youth to promote their awareness of the energy problem; 3) 5 ways by which the community can become more involved in conservation efforts to help alleviate the budget strain caused by high fuel costs. Involving the total community is our aim. We would be happy to pro- h vide ideas, support and ways to raise funds, if necessary, for your ' projects. We are excited about this unique program which is first being attempted I here in Alaska. We feel it has a great deal of potential and are con- fident that by working together we can all help to ease the ever in- creasing energy strain. Since the main ingredient of this program is you, your help and creativity will be very necessary. We hope that you or a representative of your club will make every effort to attend this meeting. We look forward to meeting you there. _ The Energy Conservation Advocates Coordinators f Division of Energy and Power Development KS:SB/njk I I THE ENERGY CONSERVATION ADVOCATES A Volunteer -Oriented Approach to Alaska's Energy Problems An energy crisis exists throughout the state of Alaska and many times the hardest hit is the lower income families. Home heating, for ex- ample, in some villages has risen from 50t to over $2 a gallon since 1974. Costs for electrical lighting and applicances in Nome averages $180 a month and Fairbanks pays an energy surcharge which results in $500 monthly electrical bills for a large number of families. These energy problems affect nearly every aspect of life of Alaskans. The high cost of fuel and electricity has forced too many families to choose between essentials such as food, shelter and clothing; and fuel for heat in their homes and transportation. Despite public concern about these problems, there has been no public program through which Alaskans can identify their community's energy problems and channel their efforts in determining what solutions they can use. To fill this vacuum, the Division of Energy and Power Devel- opment of the Alaska Department of Commerce and Economic Development has developed a volunteer -oriented program called the "Energy Conser- vation Advocates". Programs that the Energy Conservation Advocates will conduct are a public education and information program on energy conservation and alternative energy sources, a series of home winterization workshops, and the organizing of energy conservation projects involving over 700 Alaskan Youth. The education and information program will be given to schools and organizations throughout the state and will focus on explaining the energy crisis, how to identify your community's energy problems, what one can do to help conserve our current limited re- sources, and what possible alternative energy sources lie ahead in the future. The home winterization workshops will be conducted throughout the state and will demonstrate how to winterize your home and the sav- ings that would result, both in the terms of energy conserved and family budget dollars saved. The other part of our program, involving youth in energy conservation projects, will utilize the resources of Alaskan Youth in locally designed energy conservation projects re- lated to their community's energy problems. This is the first time that such an approach as the Energy Conservation Advocates has been attempted by a state to help answer the need for energy conservation. To succeed, it will require the time, energy and imaginations of many people. If you feel that you can volunteer any ideas and/or time for this exciting new program, please contact either Steve Baden or Karen Seelhoff at the address below: Energy Conservation Advocates Program Division of Energy and Power Development Department of Commerce and Economic Development 7th Floor, Mackay Building 338 Denali Anchorage, Alaska 99501 272-0527 • BILL a 6iLLY JO THOMPSON -Hone 262.4653 I t THOMPSON'S CORNER LOG GIFT' SHOW %6 SLRVICE "Gifts Made in Alaska by Alaskans" P. O. Q0x 1150 DOWNTOWN 90LOOTNA 60L00TNA ALA+•KA OD66B March 12, 1977 The Honorablg Ted Stevens ) United State$ Senate Washington, D.C. 20510 Dear Mr. Stevens: There is a proposal in the Dept. of interior on the Bradley Lake Hydro -electric Dam project. This will be heading your way shortly. we are sure you are aware of this project. We urge you to give this your full support. The dam project will supply energy to the Kenai Peninsula and the whole of Alaska. By creating energy in this manner, maybe it will help ease the gas and fuel shortage, and therefore stop the need for rationing of fuel. If there is a gasoline rationing in the lower 48, you can forget "Tourism" for Alaska. And that will be the end of a prosperous, glorious, economy for our state. Fishing, Oil, and Tourist are the life line and F backbone of our state. Alaska, and Alaskans are s spending thousands of dollars on and for Tourism for our State. If not for our "Outside" visitors each year, many many, businesses would be forced to close their doors. Tourism is BIG business for Alaskans, in fact it is so important, that without it you will see the damdest depression for our State since Statehood. The Damm project will not only supply energy, but will create many new jobs, as it will be a tremen- dous recreational site. Please Please help the people of the Kenai Peninsula with your full support for this project. Please stop by and visit with us on y9ur next trip home. We would love to talk with you, and maybe we could even sqweeze in a fishing trip to Homer. Si ere FFThom dr -r., BET/bjt i i ;I -1 I i i i �I i BILL a BILLY JO THOM"ON PHONE 262.4683 V � T-�OMPSONS �l�i�l�R }; LOG GIF' SHOP %6 SE[:ME "Gifts Made in Aitlska by A[usktuts' ! P.O. BOX 1169 DOWNTOWN SOLDOTNA SOLDOTNA AL ASKA 99660 i March 12, 1977 si The Honorablio'1i%e Grave United states -Senate Washington, D.C. 20520 Dear Mr.Gravel There is a proposal in the Dept. of Interior on the Bradley Lake Hydro-alectric Dam project. This will be heading your way shortly. we are sure you are aware of this project. We urge you to give this your full support. The dam project will supply energy to the Kenai Penins•.ila and the whole of Alaska. By creating energy in this manner, maybe it will help ease the gas and fuel shortage, and therefore stop the need for rationing of fuel. If there is a gasoline rationing in the lower 48, you can forget "Tourism" for Alaska. And that will be the end of a prosperous, glorious, economy for our state. Fishing, oil, and Tourist are the life line and backbone of our state. Alaska, and Alaskans are spending thousands of dollars on and for Tourism for our State. If not for our "Outside" visitors each year, many many, businesses would be forced to close their doors. Tourism is BIG business for Alaskans, in fact it is so important, that without it you will see the damdest depression for our State since Statehood. The Dam project will not only supply energy, but will create many new jobs, as it will be a tremen- dous recreational site. Please Please help the people of the Kenai Peninsula with your full support for this project. Please stop by and visit with us on y9ur next trip home. We would love to talk with you, and maybe we could even sqweeze in a fishing trip to Homer. ' Si ;e17,,,gB 1.E. Thomps BET/bjt -I ' Y I TO March 25, 1977 "M Volume III N~S Number 6 Wes a" National League Of Cities 1620 Eye St., NW. Washington, D.C. 20006, (202) 293-7310 ACTION CALL: Antirecession fir,.dl"as- CONGRESS DELAYING sistance (countetryclical) COUIMTERCYCLICAL continues its unestpect- ediy slow trip through the congressional proc- ess. senators and representatives should be informed of the impact of delays --especially for those cities now budgeting. They should be urged to support the president's proposal (S. 531 and H.R. 3730). In the House, the Intergovernmental Relations and Human Resources Subcommittee of the Govern- ment operations Committee is studying an alterna- tive formula, on the House floor, the $632.5 million PY 77 appropriation was challenged be- cause it preceded authorization but was retained by a vote of 225 to 183. While the House appropriation vote cannot be viewed as a vote on the program, it reveals a threateningly large spontaneous opposition. The Senate Appropriations Committee reported $925 million, which would fund the president's continued on pg. 4 PLSA COULD APPLY A federal district court TO SOME FUNCTIONS in D.C., in line with the supreme Court de- cision in NLC v. Usery, invalidated the Pair Labor Standards Act as applied to integral and traditional functions of states and local governments on Mar. 9. BUT, if the Labor Department finds that any function performed by any state or local government, other than operation of a railroad, is nonin- tograi or nontraditional, PLEA provisions re- garding wages and overtime could apply. DOL must give 30 days' notice to the state or local government involved or publish ouch a determina- tion in the Pederal Register. Should a state or local government dispute any ouch DOL ruling, they may take the issue to court. what's nontraditional or nonintegral? Maybe public utilities and liquor stores. --Carol Nocheieen (Federal Relations) CARTER ENERGY An outline of Pr.ssident PLAN EMERGES Carter's energy and environ- ment policy message to the Congress is beginning to emerge The message almost certainly will urge greater use of renewable energy sources, a goal that is still some years off, in the meantime, the policy likely will call for increased reliance on coal and decreased reliance on oil and natural gas, with nuclear power the energy source of last resort. Protection of the environment is going to be an integral part of efforts to develop energy sources. what isn't clear just yet is just what sorts of energy conservation recommenda- tions are to be included although conserva- tion is sure to be an important part of the package. Toward Renewable sources. solar energy is prob- ably the easiest to tap, but it is still far from being a major power source. The policy coming up next month will emphasize solar heat- ing and cooling research and development; a large chunk of money also will go into energy conservation R&D. In the meantime, coal once again will be king. The new energy policy probably will emphasize improvements in surface mining and the develop- ment of environmentally sound policies for mining coal on public lands. Research and do- velopmont programs will focus on synthetic fuels from coal and pollution controls for coal pro- duction (including cleaning and washing) and use. Cleaning and washing coal requires lots of water, and most of the new strip mining prob- ably will take place in water -scarce western states. The policy will probably include a fed- eral study to determine just how much water is available and where it is. An even bigger issue is the potential air quality problem. Burning coal will increase continued on pg. 4 i 0 711111111 M 11 F,_ i NIC URGES In testimony submitted IMPROVE14ENTS IN to the House Committee WATER POLLUTION ACT on Public Works and Transportation, NLC made several key points about the Water Pollution Control Act amendments of 1977 (H.R. 3199): e Cities support the objectives of the 1972 amendments, but because of the continuing fiscal demands being placed on then4 they can- not afford to have the federal share of waste water plant construction cut below current levels. • A key provision of H.R. 3199 would let cities use ad valorem (percentage of fixed value) taxes as well as user fees to pay for maintenance and operation of federally funded plants. NLC supports this and suggests further that future delays could be avoided if the EPA administra- tor were required to approve a community's ad valorem tax plan within 60 days of application; rejection should require a written justifica- tion. • NLC also supports section 13 of the bill, which authorizes extensions of compliance deadlines for publicly owned treatment plants until 1983. Extensions should be granted on a case-by-case basis, NLC urged, and they should be related to the availability of federal funds in the area. • NLC supported the state certification section of the bill and urged decentralization of the program's administration, calling on the committee, however, to see that red tape isn't institutionalized at the state level. • NLC also supported the additional ap- propriation for section 208 area -wide planning agencies and supported changes in the existing law that would keep the federal share from being automatically reduced at the end of the first two years of planning and eliminate the state nondesignation option from the act. --Tom Tatwn (Federal Relations) EPA ON SEWERS The U.B. Environmental SMMI IB BEAUTIFUL Protection Agency's (EPA's) current effort to promote small treatment systems for use where they prove environmentally sound and cost-ef- fective is based on recent findings that econo- mies of scale for construction of waste water treatment facilities are not as great as pre- viously believed. Local seminars on small treatment systems for public officials, EPA personnel, consulting engineers, and other concerned groups will be held Mar. 30-31 at the Marriott Motor Hotel, Philadelphia; Apr. 26-28 at the Ramada inn Central, Kansas City, No.; May 4-5 at the New Hampshire Highway Hotel, Concord; May 24-26 at the Hilton, San Francisco; and iwie 7-9 at the Cosmopolitan Hotel, Denver. Attendance at the seminars is limited. To register, contact the regional EPA offices. --Dot Bryan (Membership Services) r ­% WATER STRATEGY It's not public works but DELAYS PUBLIC water pollution issues WORKS that ase likely to divide the House and Senate when they confer over their respective versions of the new public works bill, S. 427 (passed Mar. 17) and H.R. 11 (passed Feb. 24) . There are a few important differences on public works issues. But the conflict is likely to be over Senator Muskie's strategy of avoiding an early confrontation with the House on im- portant water pollution issues by attaching urgently needed water funds ($9 billion) to the Senate public works bill. To counter the Muskie strategy, the House Public Works Committee is delaying a public works conference with the Senate until a House water pollution bill -- which will include substantive amendments to the Water Pollution Control Act as well as additional funding --can be prepared. The House committee then will either include its water amendments as part of the public works conference agenda or request a separate conference with the Senate on water issues alone. NLC supports the House approach because several important city -backed amendments will be in the House water package (see article on this page for details) . But we are concerned that the whole water pollution controversy may delay the early provision of additional public works funds and are urging a quick resolution on members of both the House and senate. Public Works Provisions. In most major respects, H.R. 11 and S. 427 are quite similar in propos- ing changes in the local public works program. Both provide an additonal $4 billion for immedi- ate obligation by EDA; largely eliminate the mandate to spend a certain part of each state's allocation in areas with low unemployment; establish set -asides for Indian tribes and to correct earlier EDA funding errors; eliminate the gerrymandering of project areas; allow ap- plicants to establish local priorities; and establish a uniform 12 -month period for unemploy- ment data. Some controversy is expected over the differing state allocation formulas contained in the two bills. H.R. 11 drastically reduces funds to states with high unemployment rates by using only the number of unemployed persons in each state to distribute funds, while S. 427 reserves 35 percent of all funds for distribution to states with unemployment over 6.5 percent. Another issue to be resolved is whether new ap- plications will be allowed or whether all funds will be spent on the current unfunded applica- tions (some 20,000) on file with EDA. The House bill is vague on this point, but S. 427 would allow new applications from current applicants that have insufficient grant requests on file with EDA to cover their fair share of additional funds. The two bills are also different on the school district question, with S. 427 clearly continued on pg. 4 I 1 CITIES HAVE ROLE Thio in the year tot the IN WELFARE REFORM debate on vielfary reforfi. It may start during the summor and end sometime next year. President Carter proposed reform of the welfare system during the campaign, and it's four years before the next election --a time when one may have to defend one's stand on the controversial subject. The Department of Health, Educratiun, and Welfare is talking to everybody: representatives of executive departments, congressional staff, and NLC and other public -interest groups. And hearings are being held throughout the country, some jointly sponsored by local elected officials. Fiscal Relief. For cities, reform may mean fiscal relief from the increasing costs of local general assistance programs and from the sharing in the costs of federal/state welfare programs. Because of the variances in city roles in human resources programs, it is difficult to make a more definite assessment of the potential im- pact. Regardless of the proposal adopted, it will mean greater uniformity in payments and pos- sibly federal administration of at least the federal benefit. Jobs, too. Even more important to cities will be the expanded jobs program designed to pro- vide employment, rather than public assistance. There is increasing acceptance of the idea that those expected to work should be separated from those who are not --a position supported in the NLC Employment and Income Security Policy state- ment. There are still unanswered questions facing the policy makers as they analyze an ex- panded employment and training program for wel- fare reeipientss Can persons with little or no Job experience or training be integrated with the CETA participants or should there be a separate system for that group? Wbat is the capacity of cities to operate expanded public service employment programs (as proposed in the Carter economic stimulus package) and an expanded jobs program under the restructured welfare sys- tem? HEW Secretary Califano must submit a proposal to the president by May 1. To date, there is no indication as to the direction HEW will take. But based on the views of those groups that al- ready have spoken out in favor of a larger em- ployment program rather than a larger welfare program, it appears that the city role in the new system will be expanded. --Joan Miller (Nati. Institute of Public Management) AIRPORT NOISE House Aviation Subcom- POLLUTION CONTROL mittee Chairman Anderson will hold hearings on H.R. 4539, the Airport protection and Aircraft Noise Reduction Act on Tuesday, Apr. 19, 1977. NLC is evaluating the act and will testify. --Tom Tat= (Federal Relations) at�aaa=aaaao=aanaaaa=aaaaaystaaa�saaaaaac:acaaacwa 3 BULLETS Coal is king of the fist;nil fuel ••nergy colirl:. ,, ir, Carter administration energy circles until renewable sources can be tapped •••.Look for increased R&D emphasis on solar heating and cooling demonstration projects, and retail your suitable projects to ERDA.... When it comes to gas and oil, the watchword is conservation. Loo),. for a big push toward home insulation and requirements for long-term in- creases in auto mileage performance...,/r�lph 'chlopat.riin, urban economist, formerly with the Joint Economic Coimnittee of Congress, who ori- ginally went to EDA, is now being shifted to Treasury to work with lffiyci- AZtmwt on studies that may include taxable bond options and a "domestic development bank" of some type. Prog- ress is slow despite Treasury's and Domestic Council's interest, and Carter's commitment still goes no further than campaign promise to study both issues.... -Jane flan•'_ yoy, former executive director of the Conference of Demo- cratic Mayors, is HUD's now director of congres- siondl relations, possibly signaling a more ag- gressive approach by HUD to moving its programs in Congress.... Much unhappiness at the White House over the Senate's reversal of the presi- dent's third budget amendment deletion of 19 water projects. Especially nettling is the Senate amendment that calls for full restora- tion of these projects.... Best guess is that auto companies will get two more years to meet emission control deadlines. The UAW -auto company coalition is hanging tough both on the Hill and at the White House. aaaaaa=cam==wean»aaa-:sa=c_aeaaaaaa�aaaa.aaa=a=aa HIGHWAY $S Senate Public Works AMBUSHED committee adopted Clean Air Act amendments to S. 252 which would with- hold highway funds from any local government that has not implemented a transportation con- trol plan. Senators who are pushing this amend- ment are Domenici, Hart, Gravel, Culver, Anderson, and Chafee. HLC opposes such sanctions. --i}m Tutor (F(.dvraZ Relationo) y pn.�161F IIII •- �.I __- I I aauaaaaaaaaa=afa==aaa=aaaa:3aaaa=aaaa=a=as,aaa=aa I COMMITTEE EXTENDS The House Education and CETA ONE YEAR Labor Committee (Perkins, D-Ky., Chrmn.) sent to the House for action Mar. 28 or 29 H.R. 2992, a simple one-year extension of the Comfrehensive Employment and Training Act (CETA). Tile committee rejected administra- tion amendments to give Vietnam veterans hiring preferences in public service jobs programs and to repeal the 20 percent requirement in Titles III and IV. (Repeal would permit the administra- tion to seek additional funds for existing or new categorical programs without increasing Title I funds fox prime sponsors. The existing legislation gives 20 percent of all CETA funds, except Titles II and VI to the secretary of labor to fund directly employment programs he deems important.) --Carol Koeheioen (Federal Relations) �a3ae -aa =JL tt.i==uaY.� »'-•�a»� s. :.r "-.•. . -=Cw3csGu.aaaLu"paa i ACTIOG CALL: :;t,m,a 56,000 Anm�ricas, EPA WANTS COMMENT i indalitr.ial plants dis- C4i SEWER D_ISCHAWMS charge into municipal aewf,rag(f systems pol- luted waste watf_r that impairs the plants' op- erating efficiency, parse,fi through them without treatment, :,r creat, -f, f.ludyc ),rublomf;. The envircrumental Protection Agency (EPA) wrote regulations for a program that would require plants to pretreat auch wastes so that they don't foul sewer systems or, otisorwise, prohibit their discharge into publicly owned systema. EPA will hear public comment on theae regulations Apr. 7 at the Hyatt Regency in San Franciscot Apr. 14 at the Park Plaza, Boston; Apr. 19, the Pick Con- gress, Chicago; and Apr. 21, Civil Service Com- mission Auditorium, Washington, D.C. EPA will brief selected btate and local officials on the regulationn Apr. 6 at the Hyatt Regency, San Francinco; Apr. 13, Park Plaza, Boston; and Apr. 18 at EPA's office in rhicago. If you want to attend these briefings, call or write Jeff Fletcher at ULC, (7.02)293-7349, so he can reserve space for you. --Dot Bryan (Membership Services) caccacauaaaaaaacacaacca=ccccacaaaaccaa=ac^----- $450 MIL PLUG The Carter administra- FOR MAKY WATER tion has proposed a 8YSTEMS drought relief program to give $150 million in grants and $300 million in low-interest loans to communities for emergency improvements in their water systems. The money is to be fplit evenly between communities over 10,000 (through the Economic Development Administration) and those below 10,000 (through the Farmers Home Administration), and it would be used for es- sential, quickly done improvements. The proposal also provides for 050 million in ` low-interost loans to small businesses in drought I[f areas, $14 million for the Southwestern Power Adminiotration to insure an adequate energy supply and a variety of programs to aid drought - hit farmers. I j All the programs are designed to expire on Sept. 30, 1977 (a "sunset" provision). I In his message, President Carter told Congress that "water conservation is our only hope for immediate relief. Aa a nation, we must begin - - to conserve our water supplies, and government -- at all levels --must lead the way." --Clint Page (Cammmioatione) CONGRESS DELAYING continued from na. Z recommended increases for both the April and July quarters. The authorizing legislation like- ly will be offered as an amendment to the tax bill sometime after Mar. 29 and probably won't reach the House until after the Easter recess, Apr. 8 -18. --Leo Penne (Federal Relations) caaaa-_ccaccnacacaaacccaaa-aaaaaccaaaaaaaocaaoaa 4 ,- -- -- -- HATER STRATEGY continued from pq. 2 grantinq school dintricto equal priority with cities and counties and H.R. 11 not addressing the question. Finally, it should be noted that the $1.5 billion Youth Community Improvement Program originally included in S. 427 was dropped on the senate floor in favor of compromise youth employment legislation to be introduced in the near future. (See Mar. 11 WR for an outline of the compromise youth legislation.) A detailed outline of the [louse and Senate bills is available from NW. Call (202)293-7380. --Julie Bingham (Federal Relations) a�aacaaaaaaaaaaaaaaaaas.aanasass--- --__- CARTER ENERGY continued from p(1. Z the concentration of fine (loss than 1 micron) particles in the airs these are difficult to control and and up deep in the human respiratory system. The best controls aren't yet available, and while the new policy will call for signifi- cant increases in the amount of money going for pollution controls.the eventual shift to coal should not come before there has been time to study and solve the potential environmental problems. Another issue related to coals strip mining of western coal will probably create a lot of coal boom towns. A federal study to help energy boom towns deal with these new growth problems is probably going to be part of the program. More Gas, oil. Production of oil and gas will continue and increase through added offshore drilling. Throughout this additional drilling, the policy should emphasize additional federal authority to protect the interests and environ- ments of communities and states along the shore. Last Resort. Nuclear power will move to the end of the line because the problems of waste disposal and security are so great. Since there are nuclear planta already in operation or on the way, however, a full study of what to do with the nuclear waste that has already piled up is needed. What About Conservation? Urban energy conserva- tion is going to be important. one approach could be to use utility companies as the vehicle for increased insulation of the existing housing stock, with costs passed on to customers through utility bilis. Its quick, pragmatic, easy -to - finance, and it has the added attraction of creat- ing jobs. Automobiles, big users of energy, are not being ignored. The administration is closely guarding its policy on engine size, increased gas mileage, and extension of emission controls deadlines Mc recently called for strict emission controls with no deadline extension). Best guess: some- thing close to a ten-year program, which would see real results in the mid-1980s. ^_-^---aaaaaaaaaacamcaaoaaaaaaaaaaaaa 4 mills 111113 P I 4 - T- --- . .-..-_-:_ ... __. - j- it I_INIJI/II _IIIIIIM II ill . _ .1. 11 13 �4 Alaska P#tsfithzz p�i� HOUSE COMMUNITY and REGIONAL AFFAIRS COMMITTEE L i Luba Rudd, Chau Pouch V, Staate-Capito.t Juneau, Atadha 99811 (907) 465-3810 The House Community and Regional Affairs Committee will hold hearings on the following bills during the week of March 28, 1977. Monday, March 28 HB 273 Third Class Boroughs Tuesday, March 29 HB 219 Permits and fees for construction Wednesday, March 30 8:00 a.m. Room 123 HB 219 Joint Hearing with Senate Natural Resources HB 342 3:00 p.m. Room 120 Thursday, March 31 SB 47 Friday, April 1 SB 126 facilities associated with the Outer Continental Shelf. Management of the coastal resources of the state. Municipal property tax exemptions. Runoff Requirements in Municipal Elections The committee will meet in room 123 of the Capitol Building in Juneau at 8:00 a.m. Monday, Wednesday and Friday, and at 9:00 a.m. Tuesday and Thursday. We would be very happy to receive testimony from you on any of -these bills. You may appear in person at the hearings or you may submit written testimony to: Pouch V, Juneau, Alaska 99811. Lisa Rudd, Chair LTIVE A 710N E"LSCA "YOUR MUNICIPALITY HAS A BRANCH OFFICE IN THE CAPITAL" IX-GTSLATTVr. BULLE"IN # 9 voxll 21,1977 T'IDEX (Refore to previous bulletins for bills not listed in this index) General Committees I Le5islative Committees 1 Legislative Telephones 2 TIOUSE BILLS RB 72 Historical Districts 2-400-9 CS11B 84 Votinq Polls 2-9 ED 89 School Construction Aid 2-6,8-9 11B 106 Gross Business License Tax 3-9 ED 110 Planning and Zoning 3-9 ED 131 Freedom of Information 6-9 Hb 134 Ordinance Violation 3-7,9 ED 147 Public Projects 4-6,3-9 ED 153 Conventions and Travel 4-9 ED 190 Air Pollution Control 5-7,9 ED 209 Utilities and Right of Ways 5-7,9 ED 240 Alcoholic Beverages 7-9 HB 243 Public Meetings 7-9 ED 254 Public Information 7-9 ED 256 Raw Fish Tax 7-9 1113 273 Third Class Boroughs 7-9 TIB 305 Alcoholic Beverage Sales 8-9 HB 324 Property Tax Exemptions 8-9 ED 342 Coastal ",one 11anagement 9 ED 348 Farm Use Lands 9 1113 354 Public rntity Liability 9 JIB 372 Unemployment Insurance 9 AL i ill lit VA_ 03 - -' ^---^-� - - -- - -- --- l-` -•-T - -- a< -�"� _'� "- ---.. -rte "•'�,.- "-�.'�!_"" :,._,_.i+r�aw.�ecrc.-_.-� .• - - -' "C. _- _ ..: v.. .-_ ... __._. - milli iIll ili II - r `I 1 i� jl SENATE BILLS - Sn 47 Property Tax Exemption 2-4r9 SB 50 Utilities and Right of Ways 6-9 SB 89 Court Proceedings Bonds 3-9 SB 114 Public ! orks 4--6.8-9 SB 126 Runoff Elections 4-6,8-9 SB 127 Tax Foreclosed Property 4-6r8-9 SB 172 Foreclosure Notices 7-9 SB 179 Judicial Service Costs 7-9 SB 182 Municipal. Sales Tax 7-9 ' SB 183 Alcoholic Beverages 7-9 SB 201 School Construction Aid 8-9 SB 208 Municipal Organization Grants 8-9 SB 210 Property Tax Repeal 8-9 ' SB 220 Coastal Zone Management 8-9 SB 223 Borough Charter 8-9 SB 227 Enviormental Coordination Procedures 8-9 SB 234 Religious Recreation Property 8-9 SB 241 Municipal Land Selection 9 SB 249 Public Entity Liability 9 SB ' II 259 Municipal Utilities 9 HOUSE BILLS HB 72 Historical Districts Has recieved no further action in the Finance Committee, HB 84 Voting Polls Has recieved no further action in the Senate State Affairs Committee. HB 89 School Construction Aid Has recieved no further action in the Finance Committee. HB 106 Gross Business License Tax Has recieved no further action in the Finance Committee. HB 110 Planning and "oning Has recieved no further action in the Senate CRA Committee. HB 131 Freedom of Information Has recieved no further action in the Judiciary Committee. HB 134 Ordinance Violation This bill has recieved a "do pass" recommendation from the Senate Judiciary Committee and the bill has been refered to the CRA Committee. HB147 Public Projects Has recieved no further action in the Rules Committee. HS 153 Conventions and Travel Has recieved no further action in the Finance Committee. 11B 190 Air Pollution Control A substitute bill has recieved " do pass" recommendation from the CRA Committee and has been refered to the Rules Committee. Hb 209 Utilities and Right of flays This bill has recieved a ""da pass" Recommendation from the State Affairs Committee and has been refered to the Rules Committee. HB 240 Alcoholic Beverages Has recieved no further action in the Judiciary Committee. HB 243 Public Meetings Has recieved no further action in the State Affairs Committee. HB 254 Public.information This bill has recieved..a "do pass" recommendation from the State Affairs Committee and has been refered to the Rules Committee. (1) T - - -, T- r-- - , fir IL 0 HB 256 Raw Fish Tax This bill has recieved a "do pass" recommendation from the CRR Committee and has been refered to the Finance Committee. HB 273 Third Class '3oroughs Has recieved no further action in the CRA Committee. HB 305 Alcohol3.c Beverage :ales Has recieved no further action in the Cowiierce Conutittee . HB 313 :Municipal `tanagers Has recieved no further action in the CRA Committee. IiB 324 Froperty Tax Exemption Has recieved no further action in the State Affairs Committee. HB 342 Coastal Zone Management Introduced by the Rules Committee at the request of the Joint Administration - Legislative Committee on Coastal *lanagement, this bill is identical to SB 220.(See page 4, bulletin �$.) The bill has been refered to the CRA Committee. HU 348 Farm Use sands Introduced by the Rules Committee at the request of the Governor, this bill provides that reimbursement for property tax revenue lost on farm lands is a lien in favor of the state against the property for which a partial tax deffered payment has been approved and granted. Upon recordation in the recording office of the district in which the property is situated, the lien is prior and superior to other liens against the property except for taxes due the municipality under this chapter. The department of law may enforce a lien arising under this subsection as provided in AS 09.45.170-09.45.220. The lien becomes enforceable on change of use of the land to a purpose not compatible with farm use. The bill has been refered to the Resources and Finance Committees. HB 354 Public Entity Liability Introduced by Nakak and 5 other Representatives, this is the Lbague drafted limiting liability of municipalities in certain actions. This is probably the most important legislation the League has been able to have introduced in years and your support is absolutely necessary. The bill has been refered to the Judiciary Committee. HB 372 Unemployment Insurance introduced by the Rules Committee, at the request of the Governor, this bill is in response to federally -mandated coverage of public employees under unemployment insurance. The bill has been given to members of the Leagues Legislative Committee for review on our behalf and their suggestions will be reported to you. The bill has been refered to the Labor and rlanagement and Finance Committees. (2) i 4.:r.reurr11.1i ilii ! a V, SENATE BILLS SO 47 : Property Tax Exemption This bill passed the. Cenate, 16-3, March 17 and has been refered to the House CRA Committee. SB 50 Utilities and Right of Ilays This bill has recieved a "do pass" recommendation from the Commerce Committee and has been refered to the State Affairs Committeer SO 89 Court Proceedings Bonds Iflas recieved no furthor action in the House Judiciary Committee. SB 114 Public Works Has recieved no further action in the House State Affairs Committee. SD 126 Runoff Mections Pas recieved no further action in the House CRA Committee. SD 127 Tax Foreclosed Property Has recieved no further action in the CRA Committeq. SD 172 Foreclosure.noticas Has recieved no further action in the Judiciary,Committee. SO 179 Judicial Service Costs :.Has recieved no further action in the CRA Committee. SO 182 Municipal Sales Tax Has recieved no further abtion in the Special Committee on Alcoholism. 58 183 Alcoholic Beverages Has recieved no further action in the Special Committee on Alcoholism. SB 201 School Construction Funding Has recieved no further action in the HESS Committee. SB 208 Municipal organization Grants Has recieved no further action in the CRA Committee. SO 210 Property Tax Repeal In Bulletin we reported this bill as having been refered to the Resources Committee. Actually, it has recieved no further action in the CRA Committee. SD 220 Coastal Zone Ilanagement Has recieved no further action in the :Resources Committee. SB 223 Borough Charters Has recieved no further action in the CRA Committee. SO 227 Enviormental Coordination Procedures Has recieved no further action in the Resources Committee. (3) It In 11 F`1 oil --t ��... , �• _ ...,... ___. _.... ,_ . - - _-_ - - - __ ,_--=_�pe.e...n.asrr nrlu r�r� Ell 411111111 1 JR! u. _.J.. ! L I. 111 I I U SB 234 Religious Recreation Property Has recieved no further action in the Resources Committee. Sia 241 Municipal Land Selection Introduced by the Mules Committee at the request of the Governor, this bill =stablishes detailed procedures for the transfer of state lands to municipalities. The purpose of the bill is stated as follows: The purposes of this act are: to remove existing inequities and uncertainties in the existing municipal land sQl�ction law of the state; to provide for an immediate, final determination of municipal land entitlement; to provide for the completion of rational ownership patterns for sound land management within five years; and to provide for timely patents of lands to municipalities to fulfill their respective entitlements. The bill has been refered to the CRA and Finance Committees. SB 249 Public Entity Liability Introduced by Ray and eight other Senators, this bill is identical to I:B 354.(See page 2, this Bulletin.) This bill has been refered to.the CRA and Judiciary Committees. The CRA Committee held a hearing on the bill, March 17, at which time members of the League Board of Directors and Legislative Committee testified along with other supporters of the bill. SB 259 ,municipal. Utilities Introduced by the CRA Committee, this bill provides that if a political subdivision owns and operates more than one utility, only those utilities in actual competition with another utility are subject to regulation by the Alaska Public Utilities Commission under this chapter. Notwithstanding any other provisions of this chapter, collection and disposal services of garbage, refuse, trash or other waste material provided by a municipality within its corporate boundaries are not subject to regualtion by the Alaska Public Utilities Commission unless the municipality elects to be subject to the provisions of this chapter. The bill has been refered to the CRA Committee. (4) 8 E ui Or A L Ahs' JUNEAU ALAUKA I 'Alaska t�#e —AD,9 e M E M O R A N D U M March 15, 1977 To: All Interested Individuals From: Senator Kay Poland - OQ Chairman `� Senate Resources Committee Re: SB 220, Management of the coastal resources of the state. Please be advised that the Senate Natural Resources Committee will be holding a hearing on coastal manage- ment, Wednesday, March 30, at 3:00 p.m., Room 126, Capitol. Any persons wishing to testify or present written testimony may contact my office at 465-3717 or 465-3791. I 6 i I 1 I I I I I 1 I A- ALASKA CURRENT- LY ALASKA COMAL r ANMEMENT PAOQMM march 1977 1 THE 8 AUA UME111Y I S A MONTHLY PUBLICATION, FOR INFORMATIONAL PURPOSES, PRODUCED BY THE ALASKA COASTAL MANAGEMENT PROGRAM PFFICEADQF THE GOVERNOR OUCHJUNEAU, AK 99311 THE D-2 LANDS ISSUE by David R. Cline The greatest conservation battle in Alaska's history is about to erupt on the national scene. Alaska Senator Ted Stevens puts it this way: "The battle shaping up over legislation on the D-2 lands will make the battles for statehood and the trans -Alaskan pipeline look like Sunday afternoon tea parties." What's behind all this? And why should you be concerned? Let's first consider what led up to where we are now. At statehood in = 1959, Alaska was guaranteed the right to select 104 million acres of the Great Land's 375 million acres to insure a viable economic base for its citizens. This represented the most generous state land grant in American history - larger that all the combined federal land grants to all 14 western states. Not to be overlooked are the additional 45 million acres of tide and submerged lands also transferred to state ownership. 1 Unfortunately, the Statehood Act ignored claims by Alaskan Natives that much of Alaska belonged to them by aboriginal right, thus the need for pas- sage of the Alaska Native Claims Settlement Act (ANCSA) in 1971. The pri- mary aim of the ANCSA (beyond expediting construction of the trans -Alaskan pipeline) was to help secure the Native's future by awarding them $962 i million dollars in cash and almo$t 44 million acres of ancestral lands. In ANCSA the Congress also wisely addressed a third critical Alaska land issue, i.e., how to best protect the national interest in the nearly 230 million acres of land to remain in federal ownership following state and Native selections. Thus in Section 17(d)(2) Congress directed the U.S. Department of the Interior to study up to 80 million acres of public land in Alaska for possible inclusion in the National Wildlife Refuge, National Park, National Forest and National Wild and Scenic River systems. These are the so-called "D-2" lands. -more- If you have moved since the last issue of the Alaska Currently was mailed to you, or you know of someone who would like to receive it, please let the Alaska Coastal Management Program office know. (Gordy Euler, 465-3541) in this issue: The D-2 lands issue. . .Alaska Public Forum. . .Progress in Coastal Management. . .Coastal Management Legislation. . .Public participation in coastal management. . .ACIC. « .From the Press. 4 D "Mdej The studies have been completed and proposals developed. Most conserva- �, tionalists view the government's plan as excellent as far as it goes, but too conservative none -the -less. They have therefore organized an Alaska Coalition, developed their own proposals and presented them in bill form. Their D-2 bill along with several others are now before the Congress, which has a self-imposed deadline of December 18, 1978 for taking action on the is proposed legislation. And knowing how long it takes to move controversial legislation through the national political mill, conservationalists have decided to start pushing now - strong and hard. To this end, Congressman Morris K. Udall (D -Arizona) has introduced the Alaska National Interest Lands Conservation Act of 1977 (HR 39). Conserva- tionalists are delighted that there are currently 75 co-sponsors for the Udall bill. The letters and telegrams coming into Congressional offices have already had an enormous impacts most of those members co -sponsoring the legislation were responding to this mail from home. Alaska's Congress- man Don Young is not among the co-sponsors, however, and needs to hear from Alaskans on the issue. Interested persons can write both Congressman Udall and Young (all Congressmen can be addressed at: House Office Building, Washington, D.C. 20515) on this unprecedented conservation initiative, and express their views, be they pro or con. i The House Interior Committee chaired by Mr. Udall recently established i a new Oversight and Alaska Lands Sub -committee which will have sole juris- diction over the whole Alaska lands issue. John Seiberling of Ohio, one of the foremost environmental spokesmen in Congress, will be the chairmen. This new development is received with great excitement by those working on the D-2 lands issue, for it guarantees that their views will be heard. Once the Congress has dealt with the high priority strip mining legis- lation now before it, Mr. Seiberling's subcommittee anticipates holding field hearings on the Udall bill in Alaska and key cities in the Lower 48. This is expected to occur in early summer. The hearings will be followed by a "show me" trip to Alaska now being planned for House and Senate Interior Committee members and their wives for the August Congressional recess, The Carter Administration has yet to develop a firm position on the D-2 i lands question, but is watching proceedings in the Congress with keen interest.; Key advisors are well aware that the proper decisions on this issue may well afford Mr. Carter the opportunity to become the greatest conservation President since Teddy Roosevelt. Without question, conservationists view the Alaskan national interest 4 lands as providing the last and greatest opportunity of our lifetime to dedicate vast and yet unspoiled ecosystems large enough to provide lasting protection to their unmatched wildland and wildlife values. The degree to which Alaskans and other U.S. citizens get involved will to a large extent determine the final outcome. These and other questions pertaining to the Alaska D-2 lands issue will be addressed in ensuing editions of the Alaska Currently in our attempt to keep you fully informed as events unfold. (Dave Cline is federal programs coordinator for the Alaska Coastal Management Program in Juneau. For further information he can be contacted at 465-4974). I T- - - - - + -N FOUR RECENT PROGRESS IN THE COASTAL PROGRAM Since the last issue of the Alaska Currently, the Alaska Coastal Management Program has secured a third program development grant, and is now well underway with the tasks set out in the third year grant application. Some of these are: 1) Polic Development. This task is an effort to unite and aggregate the existing State policies on a variety of coastal issues, and, if neces- sary, to come up with new policy on issues where it is needed. The first step of aggregating State policy has been taken by Alaska Coastal Management Program staff and the result of the effort is now being ex- amined and expanded by several State agencies. A draft set of policies will be available for public inspection at the end of April. After April, the results of public review and the public participation pro- ject will be added to the draft policies and a new draft will be cir- culated. 2) Public Participation. Aside from starting up publication of this news- letter, the public participation effort is undertaking two other pro- jects. These are reviewed in the article in this issue entitled "Public Participation in Coastal Management." 3) Other Program Projects. Other program projects such as coastal zone boundary determination, wildlife inventory, land management system development, and identification of authorities are all proceeding on schedule. By the end of April, we expect to have a rough draft docu- ment that summarizes all of the current and past work projects and which unites them into a program framework. 4) Local Government. On the local government side, about a dozen local governments are close to completing grant arrangements and will be starting various coastal projects of their own in the near future. For fiscal 1977, grants will be awarded to the Municipality of Anchorage, City and Borough of Juneau, Kenai Peninsula Borough, Ketchikan Gateway Borough, North Slope Borough and the City of Unalaska. These grants will probably be extended into fiscal 1978. Others that have expressed interest in possibly undertaking a program are the City and Borough of Sitka, and the Cities of Dillingham. Kotzebue, Nome, Skagway and Wrangell. For more information on this, contact Mark Stephens or Paul Carr, Department of Community and Regional Affairs, Juneau. Please contact Glenn Akins or Murray Walsh of the Alaska Coastal Management Program if you are curious about the details of any of these projects. .A�'"w.�"'..... I.A I411 I . I A ..N( . .I 1_ I I d __AM.t t THREE ALASKA PUBLIC FORUM BREAKS THE ICE The Alaska Public Forum has added a new dimension of government in Alaska. At a time when a complex array of decisions confront Alaskans and their leaders, the State has taken the initiative in involving the public in studying and selecting the best options. i The Public Forum is directed by the Alaska Growth Policy Council, a group created by Governor Hammond to include the points of view of citizens on important state issues. Quite simply, the Forum is designed to broaden citizen involvement in government, a goal sometimes forgotten by our public servants. Workshops have been conducted in the Southeast, North, South Central and Copper River regions of Alaska. In addition to workshops, the Forum also conducts local meetings for those unable to attend the regional work- shops. Southwest, Gulf Coast and Interior workshops will be held during March and April, with a statewide workshop scheduled for May. Workshop participants receive a briefing paper describing the major issues confronting the State, along with the options available to the State in dealing with these. The questions dealt with by the 1976-77 Forum are as follows: 1) How should the State use its new oil and gas money in the future? 2) What human needs are most important? How should the present State efforts in these same areas be rated? 3) How should public school construction be financed in both organized and unorganized boroughs? 4) What should the primary objective for managing Alaska's lands? 5) What should the State policy on future oil and gas sales be? 6) What is the best use of Alaska's royalty from oil and gas production? 7) What other important State problems do you feel should be considered? The Alaska Coastal Management Program has been working closely with the Public Forum. Coastal Program staff have attended Public Forum workshops to assist in answering coastal resource -related questions, as well as to learn of issues which need to be addressed in coastal management workshops. Through the combined efforts of the Public Forum and Coastal Management workshops, we hope that the majority of interests and issues concerning the Alaska coast will be brought to light and addressed. If you have any questions concerning the Public Forum and its efforts, or would like to receive its questionnaire, write to Alaska Growth Policy Council 429 D Street, Suite 310 Anchorage, AK 99501 3 i Cl trs..i a I.II i . u FIVE COASTAL MANAGEMENT LEGISLATION It seems likely at publication time that a coastal management bill will j i be introduced in the legislature this year. The bill is the result of the work of a committee established by House Concurrent Resolution 123 during the :last session. 1 !' The "123" Committee was chaired by Senator Kay Poland and DNR Commis- sioner Guy Martin. Other committee members included Senator Clem Tillion, and Representatives Sam Cotten and Nels Andersen, Commissioners Don Harris and Lee McAnerney, and Dr. Robert LeResche of the Governor's Office. The Committee met during the fall and developed a draft coastal zone management (CZM) bill which was mailed to coastal communities and Native groups in late November, 1976. After review by state agencies, coastal communities, federal agencies and the Legislative Council, the Committee discussed final revisions to the bill before a possible introduction by the Senate Resources Committee. The bill has three main parts. First, boroughs and organized communi- ties (and service areas in the unorganized borough) are required to develop local coastal management plans for review and approval by the Alaska Coastal Management Council. The Council is composed of local and state government officials appointed by the Governor. Second, state agencies must issue per- mits and conduct regulatory activities consistent with approved local pro- grams. Finally, the State will use coastal management guidelines and ap- proved local plans to assure that federal agencies respect state and local views regarding protection and development of coastal resources. At stake is the receipt of millions of dollars in federal funds for coastal planning and management for local governments and state agencies, and eligibility for local communities to receive grants and loans to off- set impacts from offshore oil development. More importantly, the coastal management bill will establish a better means for coordinating the actions of the state and federal agencies and local governments in dealing with offshore and coastal resource development. For further information, contact Glenn Akins, ACMP, 465-3574. PUBLIC PARTICIPATION IN COASTAL MANAGEMENT A In order for coastal management to be effective, the public must be informed about resource decison-making to the maximum possible extent. As well, the public must be given every opportunity to comment on, criticize and be vocal in the decision-making process as it Relates to uses of coastal resources. The rules and regulations published by the Department of Com- merce pursuant to Section 305 of the Coastal Zone Management Act state that public participation is an essential element of development and administration of a coastal zone management program. Through citizen involvement in the development program, public needs and aspirations can be reflected in use de- cisions for the coastal zone, and public support for the management program can be generated. -mo re - I k- F_ SIX y How does this involve you? Currently, the Alaska Coastal Managemen¢- Program staff is working on methods to solicit public input and encourage i public participation in the development of a coastal management program t the State. We have settled for the time being on three ways to interact i with the public. First of all, workshops will be held around the State between now and i the early part of summer. One is scheduled for Sitka on Saturday, March 12. We would like to hold as many as five or six other regional workshops, plus other evening sessions for persons that cannot attend the regional sessions. The workshops will allow local citizen participation, giving them an opportunity to voice concerns about local issues that state and federal agencies are involved in. Letters have been sent to 35 coastal communit'•- asking if they would be interested in having a workshop in their area. Representatives of the Coastal Management Program and other state agenc• would be prestnt at these meetings. As another means of informing the public, a "contact committee" is being organized. Members of this committee will be representatives of various major Alaskan interest groups. Letters of invitation to be a pant of the contact committee have been sent to the Alaska Chamber of Commerce, the Alaska Municipal League, the Alaska Federation of Natives, the Alaska Center for the Environment, the Alaska Visitor's Association, the United Fishermen of Alaska, the Alaska oil and Gas Association, the Alaska Miner's Association, the Alaska Logger's Association and the Alaska Rural Develop- ment Council. The contact committee won't function as a formal advisory body, but will be kept informed by mailings and personal contact with ACMP staff members as to state coastal management developments, so that committee members can keep their groups informed. We are open to suggestions for ad- ditional representation on the committee. Our third public participation method will be the revamping of the Alaska Currently, a monthly newsletter that has been put out by ACMP staff in the past. It will serve as a medium not only for us to get information current events to you, but for getting articles, editorials, information viewpoints to as many other persons, groups, legislators and government :ies as possible. We invite interested persons to write to Alaska Currently Alaska Coastal Management Program Pouch AD Juneau, AK 99801 with comments about coastal management, so that others may share your con- cerns. We here at ACMP are taking our responsibility for public participation very seriously. We hope you will help insure that our efforts are success- ful by attending workshops and by voicing your concerns to us, so that coastal management in Alaska will reflect your way of life. k 9 f SEjn'! N ALASKA COASTAL, INFORMATION CENTER The Alaska Coastal Management Program is trying to establish an off that wouid provide information on request concerning management of coast resources, Only a well-informed public can cope adequately with the high -press tactics of large oil companies, rapid community growth, and other proble brought by coastal resource developments. The ACMP has recognized the n and demand for an information services center to facilitate decision -mak on coastal zone issues and conflicts. Because of its recent commitment active public participation, th ACNP staff also wants feedback from the public in coastal communities - an educated commentary usually has more impact than uneducated rhetoric or even impassioned pleas. Presently, t Alaska Environmental Information and Data Center (AEIDC) handles public and agency inquiries for information about the State of Alaska. But AEI is not funded to seek out public information requests. The Office of Coastal Zone Management (OCZM) in Washington, D.C. is currently funding the development of eight Regional Coastal Information Centers (RCIC's) for use by coastal states down south. However, no RCIC is planned for Alaska despite the fact that Alaska has over one-third of the total U.S. tidal shoreline. Recently, however, the AEIDC has submitted a proposal for the devel+ ment of an Alaska Coastal Information Center (ACIC). The RCIC would be of the AEIDC in Anchorage, but would be primarily responsible to the Ala Coastal Management Program staff in Juneau. The ACMP staff feel this would be the most ideal situation possible The ACIC would utilize the information retrieval equipment and expertise the AEIDC, including their interdisciplinary scientific staff. Funds spy in setting up the ACIC would not be wasted, but rather would be used to 1 plement the job initiated by the AEIDC. The ACIC would follow the lead of the AEIDC in publishing a compre- hensive bibliography, but would concentrate on Alaska coastal zone infori tion. It would also use the AL;IDC referral file to redirect questions to experts (including "old-timers") who carry a wealth of current and historic knowledge about Alaska's coast in their heads. Bibliographies would be sent to communities for public distribution, and a monthly article in the Alaska Currentlywould keep users informed on new contacts, publications and other informaton sources available. PA .;rte •-� - - EIGHT z FROM THE PRESS judge nullitieti Atlanti*c - NEW YORK (AP) The federal government's first oil and natural gas leases in the Atlantic Ocean wert nullified Thursday by a U.S. District Court judge, who said they violates environmental law. The action by Judge Jack Wein- stein forbids any drilling on the 214,000 acres, 50 to 90 miles off the coast, that were leased to 39 oil com- panies for $1.13 billion last August. Before drilling can occur. the Interior Department must rework its study of the environmental impact, which could take several months, and then hold a new lease sale, an attorney involved in the case said. But Weinstein said his decision would not take effect until the gover- nment has had a chance to appeal it, and Asst. U.S. Atty. Cyril Hyman, who represented the government, said that was being considered. Interior Secretary Cecil D. Andrus said his department was seeking a C. of the decision and will decide .r to seek an appeal. ,al oil companies had planned drilling this spring on their hich lie in a geological for - :ailed the Baltimore Canyon Trough extending from Long Island to Delaware. It usually takes about •,)ur years from the start of exploration for oil. if any is found, to start flowing ashore. Weinstein's decision contained traces of the argument he made last August, when he temporarily blocked the sale. His preliminary injunction then was overruled by higher courts, but left standing was a request by the Natural Resources Defense Council and several New York counties for a permanent injunction. Weinstein said in both decisions that the Interior Department failt d to consider that some counties might refuse on environmental or other Rrounds to allow pipelines from off• shore wells to cross their boun- daries. This would require the use of tankers, which are more risky environmentally than pipes, to bring the oil ashore. But Weinstein went further in granting the permanent injunction. Hesaid the federal government. —Didn't study the environmental impact of specific pipeline routes. although the industry has already projected possible locations. —Overestimated the possible oil and gas in the area and .jr.- derestimated the cost of recovering it. If only small amounts of oil wf•re found, companies might prefer to use tankers instead of pope. —Didn t consider where pipes nught be laid wheh it selected the tracts it sold —Didn't consider exploring the area to determine how much oil might be lhf•re btfore granting exclusive right% to production. Anchorage Daily News, ?-16-77 Beaufort Sem Oil Rig Uses Safety Inaention A new invention, designed to catch oil well cuttings and waste dril- ling fluids as they come from the well, is being used for Union Oil Co.'s exploratory well now being drilled from an ice Island in the Beaufort Sea. The new unit, known as the fluid processing system, was devel- oped by the Swaco Division of Dresser Industries to process drilling mud in the "ecologically sensitive North Slope," Dresser Industries said. Cuttings and waste drilling fluids are removed from the usable drilling fluid and stored in containers for disposal in all ecologically safe area. Union Oil is transporting the wastes to shore for disposal in a state -approved site. The unit is one of five built or under construction. It Is housed in its own winterized compartment and is moveable. It was christened in Anchorage at Stack Steel in late .lanuary, at a gathering which included a Texas -style barbecue. Similar units were fabricated by Swaco for use in the North Sea, Iran and the Texas Gulf Coast. N r Anchoratle Times, 2-17-77 New Taucs Could Aid Fishermen By HELEN GILLEITE Times Staff writer Alaska fishermen will be better off it the nation renegotiates the In- temethma! North Pacific Fisheries Commission (INPFC) treaty with Japan and Canada instead of with- drawing from the pact, says long- time commission member Elmer Rasmuson. Since the treaty, under which the three countries have traditionally divided the catch. differs from the nation's new 20mile limit law in some respects, the United States must either withdraw or try to es- tablish a new agreement. A few days aggo the State Depart- ment gave aotice of withdrawal, which order law will take effect in a year. Rasmusen, who has been with the international commission since W and currently serves as chair- man of this country's delegation, said the move "was a technical. legal step to open doors for renego- dation of the treaty to bring it into harmony with the 200 -mile litnit." NINE Rasmuson, who also sits as chair- man of the North Pacific Fisheries Management Council, told that group in a meeting here yesterday that an important part of the inter- national agreement Is the abstention line at 176 degrees west longitude, running through Atka in the Aleutian Islands. Japanese fleets agreed not to fish for salmon in the area east of this line. "I know of no one knowledgeable in the field who believes it's a good Idea to terminate INPFC," Rasmu. son sakL "Tire 20o mile limit doesn't have an abstention line. if you have a line you get 100 per cent of the fish; 0 you don't have a line and depend on negotiation based on imermin- gft of the stocks, you never get IOD per cent .. Council advisory panel member Keith Specking told the council that the House and Senate in Juneau this week had gone on record as recom- mending that the United States seek to renegotiate the treaty rather than withdraw from the commission. The council must make every ef- fort to be Inchtded In international fishery negotiations, Rasmuson told the group, pointing out that if he had been notified that the United States was preparing to give notice of with- drawal, he would have arranged to be there. "I would like to have been there because of my long involvement with It,"he said. I feel that because of my long experience with INPFC I was in a position to be helpful." . tit: mute LmParlment nas 1811rd to issue Invitations to council mem- bers to attend fishery negotiations with foreign countries seeking to fish of, Alaska's shores, he said. Replying to protestations tram U.S. State Department representa. tive Carl Price that council mem, hers are welcome at such sessions, Rasmuson Q.Aid he believes a mecha- nism should be set up to include the council. The council voted to request the State Department to arrange any necessary clearances for all its members with the understanding that only two would be designated to attend any particular session. Negotiations on this country's halibut agreement with Canada have been unrewarding at meetings held in Los Angeles and Washington, D.C., Price reported. He said he is hopeful that a new agreement can be worked out before the bilateral agreement ends April 22. Today's council session will In. elude consideration of revised man- tionaleMarrine Fishery Service and a committee report on foreign owner- ship of domestic fishing vessels. A state Board of Fisheries re- quest that foreign fleets abide by the same tanner crab size regulation im- Posed on Alaskan fishermen will be presented Szabo gof ymember Kodiak, with thboard ccouncil e All Cau►c�U s�tessituts, held in the Stllle Supreme Court courttomn on the fifth floor of the State Court building, are open to the public. U.S. Lairs Out Japanese Fishing (quota ! TOKYO (AP) — The United States has notified Japan that Ja- pan's fishing quota withln'the U.S. 2006mile fishery zones has been set at 1.190.960 tons for 1971. The quota represents a decresse of 11 per cent from last year's Japa- nese catches in Pacific and Atlantic waters, the U.S. fishery agency said today. The agency said the Japanese -' quote accounts for 69.12r cent of the overall volume of 10%= tons permitted foreign fishing fleets for the year in the two U.& fishery zones. Tuna and salmon catches are excluded from the quota The quotas are — Pacific — total 1,109.400 tons: Alaska Pollack, 8360- 400 tons. 84 per cent of last year's catch: rockfish. 81,900 tons, 48 per cent; sablefish, 19AD tons, 70 per cent; flounder. 148,800 tons, 124 per cent; Pacific cod, 89,700 tons,124 per cent; herring, 800 tons, 89 per cent; squid. 10.000 tons, 20D per cent; tanner crab. 12.500 tons, 128 per cent; sea analis. 2,700 tons, 87 per cent and others. 68,700 tons, 147 per cent. Atlantic — tota12IN tons: Ile 0 No, 102 per cent of last yen's catch; and others. 10,800 tons, 147 percent Large Japanese fishery concerns saki the U.S. quotas were reasona- ble but ernaller fishery operators ex- p elikely to beed fear tJapanese quotas were lowered the fu- ture. An ofUclal of the Japan Fisheries Association said the U.S. allocation of 888,000 tons of Alaska Pollack was acceptable but he Bald the 30 ppeerr cent cut in the quota of eablefish was severe. The association said it was send. ing a three-member delegation to the United States Monday to deter- mine American reaction to its pub- licity campaigns in the United States regarding the Japanese fishery in - The group is to visit Anchorage, Seattle, San Francisco. Boston and Washington. � g1e�UeS. agency said '- B fishing operationsonswx have to be reduced as quotas for Alaska Pollack and aablefish are Anchorage Times, 2-18-77 lower than previous catches. It added that Japan might face more severe restrictions next year. The agency said that U.S. restric- tions on tidting equipment, the per- iods and the areas have yet to be an- nounced. Agency officials estimated that Japanese payments of access fees and allocation charges to the United States this year would total about $7 million &mjw'1MVe 0 DIrective 7o Speed Offshore Leasing Congress has directed the Inte- rior Department to accelerate off- shore oil and gas leasing, Alaska's } Sen. Ted Stevens said yesterday, and since 70 per cent of the nation's outer continental shelf lies off Ales• ka's shores, "the question is where and when and under what condi- tions." Stevens, here for the congres- sional recess, said it shouldn't he surprising that Interior Secretary Cecil Andrus canceled the lower Cook inlet lease sale, which was scheduled for Feb. 23 by his prede- cessor. "He (Andrus) wanted to make the decision hirnsf lt, 'Stevens said. "The first thing thdi haupeovd after he became secretary was to be sued over his predecessor's decision (to hold the lower Cook inlet sale), if he was going to he sued, he wanted it to be on the basis of his own decision, "What he will do. i don't know," Stevens said. "But I don't think we ought to overreact to his (Andrus) acting in a rational manner. "i still believe that lower Cook inlet oil development ought to go ahead under safeguards for the fish- Ing industry and for protection of the total environmental area there, in- cluding Kachemak Bay and others. "But t think we ought to recog- nize the secretary must be in a posi- tion to personally defend the order (for a lease sale)." Stevens said there are strong forces in the Congress which believe that the development of the outer continental shelf has been delayed by industry waiting for oil and gas prices to change and trying to create a false shortage. "I don't agree," he said. "I don't think people realize the complexity of outer continental shelf develop- ment. Most don't realize that 70 per cent of it is off Alaska, I believe they are going to get a little bit better educated. Every year, members of Congress who have been there a while sound more reasonable. But when we just get someone to the Place he understands the problems, he either retires or gets defeated for re-election. By DANA ADAMS SCHMIDT (or) 19". ChdidW adencs Monitor WASHINGTON-- When the Coast Guard begins March 1 to limit the catch of foreign fishermen within the extended, 200 - mile offshore Utnit of U.S. authority, it will also begin to provide every ship fishing those waters with an important "black box." Eventually, the boxes will automatically trigger a flashing light in Coast Guard aircraft !tying over ships in patrolled areas. A fishing vessel without the transpon- der inside its black box will not cause lights to flash — and will be easily identified as fishing without a State Department license to do so. Coast Guard officials say they will be ready March I to begin limiting the catch of foreign fishermen, although It will take a while for the service to get all its new equipment and men. its new medium - range surveillance jets will arrive at a rate of one a month for 41 months begin- ning in June, 1978. The Coast Guard is preparing to expand the number of its ships, air- craft, and men, and to make use of new electronic equipment, including two 270 - foot cutters, capable of carrying helicopters. The cutters are capable of speeds up to 30 knots, which is nearly three times the Anchorage Tili!{ , 2-17-77 elm fishlimg!� speed of most fishing vessels. Four what smile of fish will be wanted by reconditioned cutters now in moth. U,S. fishermen and how many of balls will also be pressed into ser- vice making a Coast Guard total of those remaining wiii be available for 39, foreign fishermen. In addition, 41 modern medium - range surveillance jets built by Falcon Jet Corpordtion of Teter- boro, New Jersey, will replacethe23 medium - range, 20 - year - old, propeller - driven HU -16 Albatross aircraft. With these and 21 long . Anchorage Times, 2-17-77 range C-130 Hercules, the Coast Guard now , conducts search and rescue, pollution surveillance, drug interdiction, and fisheries sun vreillance. Also, five new HH82A Sikorsky "Flying Lifeboats" are to betaken out of reserves and added to the existing fleet of 75helicopters. And 800 men are to be added to the service. The Coast Guard does not have to patrol the entire 200 - mile limit -- just the areas off Cape Cod, Lang Island, and the Grand Banks of �• , . ' Newfoundland, as well as areas offALAUKs the Alaska island of Kodiak, whore cotivt i. MANOMMENT vF40MM fishing Is active. Within these limits the Coast Guard will determine how many of km n STATE Of MAM Office of the GOVOMOI of Policy DeveIOPMOAf & amPouch A D u; Alaska 99801 Mayor City of Kenai P. 0. Box 580 Kenai, Alaska 99611 LR k. f s�47: .•f 4 HOUSE COMMUNITV and REGIONAL AFFAIRS COMMITTEE I i Li4a Rudd, Chain Pouch V, State 'Capital Juneau, AZaaka 99811 (907) 465-3870 The House Community and Regional Affairs Committee will hold hearings on the following bills during the week of March 21, 1977. Monday, March 21 IIB 219 Permits and fees for construction facilities associated with the Outer Continental Shelf. Tuesday, March 22 HB 219 Wednesday, March 23 HB 342 Management of the coastal resources of the state. Thursday, March 24 HB 342 " Thursday, Evening HB 342 " Friday, March 25 HB 342 " The committee has had several changes of which we would like to advise you. We have gained two new members, Nels Anderson (Dillingham) and Bill Miles (Anchorage). The continuing members of the committee are Tim Kelly, Chris Lethin, Al Ose, Randy Phillips, Sally Smith and Merle Snider. The committee will now meet at 8:00 a.m. Monday, Wednesday and Friday, and at 9:00 a.m. Tuesday and Thursday. We would be very happy to receive testimony from you on any of these bills. You may appear in person at the hearings or you may submit written testimony to: Pouch V, Juneau, Alaska 99811. Lisa Rudd, Chair i r k E �Alttsiui �txtP '�ie�islt�ture Wit•,- �:. � ; r j March 17, 1977 KODIAK-ALEUTIAN DISTRICT WHILE 111 JU11f.AU POUCH V JUNEAU, ALASKA 09511 City Council City of Kenai P. 0. Box 580 Kenai, Alaska 99611 Dear Council Members: Enclosed for your review is a copy of SB 262, creating the Redoubt Bay State Game Refuge. We would appreciate receiving your comments at your earliest convenience for inclusion into the record of testimony. A committee hearing will be scheduled some time in April. The exact date will be announced, and all are welcome to give testimony at that time. Very trul ours, Ka Po l�dnd Y Chairman Senate Resources Committee KP:ss t r SENATOR KAY POLAND DISTRICT L P.O. BOX 40 . KODIAK. ALASKA 09015 �Alttsiui �txtP '�ie�islt�ture Wit•,- �:. � ; r j March 17, 1977 KODIAK-ALEUTIAN DISTRICT WHILE 111 JU11f.AU POUCH V JUNEAU, ALASKA 09511 City Council City of Kenai P. 0. Box 580 Kenai, Alaska 99611 Dear Council Members: Enclosed for your review is a copy of SB 262, creating the Redoubt Bay State Game Refuge. We would appreciate receiving your comments at your earliest convenience for inclusion into the record of testimony. A committee hearing will be scheduled some time in April. The exact date will be announced, and all are welcome to give testimony at that time. Very trul ours, Ka Po l�dnd Y Chairman Senate Resources Committee KP:ss t 7' Introduced: 3/17/77 i Referred: Resources a I IN THE SENATE BY RODEY, CROFT AND BRADLEY 2 SENATE BILL N0. 262 3 IN THE LEGISLATURE OF THE STATE OF ALASKA 4 TENTH LEGISLATURE - FIRST SESSION 6 A BILL 6 For an Act entitled: "An Act creating the Redoubt Bay State Game Refuge." 7 BE IT ENACTED BY THE LEGISLATURE OF THE STATE OF ALASKA: 8 * Section 1. AS 16.20 is amended by adding a new section to read: e Sec. 16.20.039. REDOUBT BAY STATE GAME REFUGE. (a) The following 1e state-owned land, including tide and submerged land, and all lands, It including tide and submerged land, acquired after the effective date of 12 this Act by the state lying within the parcels described in this sub - 13 section is established as the Redoubt Bay State Game Refuge: 14 (1) Township 5 North, Range 16 West, Seward Meridian, See - 15 tions 4 - 9, 18 Is (2) Township 5 North, Range 17 West, Seward Meridian, Sec - 17 tions 1 - 34 18 (3) Township 6 North, Range 15 West, Seward Meridian, See - 19 tions 4 - 9, 18 20 (4) Townehip 6 North, Range 16 West, Seward Meridian, Sec - 21 tions 1 - 24, 26 - 34 22 (5) Township 6 North, Range 17 West, Seward Meridian, See - 23 tions 1 - 18, 20 - 29, 32 - 36 24 (6) Township 7 North, Range 14 West, Seward Meridian, Sec - 26 tions S1/2 5, 6 - 8, 18 28 (7) Township 7 North, Range 15 West, Seward Meridian, Sec - 27 tions 1 - 24, 26 - 34 28 (8) Township 7 North, Range 16 West, Seward Meridian, Sec - 2L tions 1 - 36 ., -1- SB 262 I i� i i fi ' 1 (9) Township 7 North, Range 17 West, Seward Meridian, Sec - i'; E 2 tions 1 - 4, El/2 8, 9 - 17, 19 - 27, 30, 34 - 36 s 3 (10) Township 8 North, Range 15 West, Seward Meridian, Sec - 4 tions Sl/2 1, Sl/2 2, W1/2 3, 4 - 11, N1/2 12, 13 - 36 6' (11) Township 8 North, Range 16 West, Seward Meridian, See - 61 tions 1 - 36 1i (12) Township 8 North, Range 17 West, Seward Meridian, Sec- s tions 1 - 5, 7 - 17, 20 - 29, 32 -36 9 (13) Township 9 North, Range 16 West, Seward Meridian, Sec - to tions 19 - 21, 28 - 33. 11 (b) The state may not acquire by eminent domain privately owned 12 land within land specified in (a) of this section for inclusion in the 0' Redoubt Bay State Game Refuge. The Department of Natural Resources may 14- adopt, in accordance with the Administrative Procedure Act (AS 44.62), 151 zoning regulations governing privately owned land within the Redoubt Bay #6 State Game Refuge only to the extent that these regulations are impera- 17 tive to insure compatability with the intended use of the refuge. 18 (c) Egress and ingress to and from private property within the 19 parcels described in (a) of this section shall be allowed through access 20 corridors established through agreement among the Department of Natural 21 Resources, the Department of Fish and Game, and the private property 221 owners involved. The establishment of a refuge under this section does 23� not impair or alter existing rights of access to set net site leases. 24. (d) The Redoubt Bay State Game Refuge is established to protect 26 the following. 28 (1) fish and wildlife habitat and populations, particularly 27 waterfowl nesting, feeding and migration areas, moose calving areas, 29 spring and fall bear feeding areas, salmon spawning and rearing habitats 2L (2) public uses of fish and wildlife and their habitat, SB 262 -2- ro I particularly waterfowl enjoyment, moose and bear hunting, photography, 2 and general public recreation and viewing in a high quality environment. 3 (e) Entry upon the Redoubt Bay State Game Refuge for purposes of 4 exploration and development of oil and gas resources shall be permitted S when compatible with the purposes specified in (d) of this section; s however, all existing leases are valid and continue in full force and effect according to their terms. a (f) Land selected by a borough within the area described in (a) of 9 this section shall be included in the Redoubt Bay State Game Refuge, 10 subject to borough approval. If the borough relinquishes the selection >> of this land, the selected land becomes part of the Redoubt Bay State 12 Game Refuge. 13 (g) The establishment of a refuge under this section does not 14 impair or alter existing rights of a borough or city to select state 16 land under AS 29.18.190 - 29.18.200. is (h) Land within existing and applied for highway, pipeline, and 17 railway rights-of-way, as of the effective date of this Act, is excluded 18 from the land described in (a) of this section; however, when these 1e interests revert to the state, the land shall be included within the 20 Redoubt Bay State Game Refuge. 21 (1) The Department of Natural Resources, in consultation with the 22 Department of Fish and Game, shall adopt regulations governing the 23 issuance of permits for seasonal cabins or shelters within the refuge. 24 Upon appropriate application, permits shall be issued to owners of 25 cabins or shelters existing on the effective date of this Act. Permits 28 issued under this subsection are for a period not to exceed five years 27 and are renewable under procedures specified by the Department of 28 Natural Resources. 20 # -3- SB 262 S 10 =� Alaska O @ %tsfidure POUCH v STATE CAPITOL JUNEAU, AK 99811 JUNBAU, ALASKA 17 March 1977 COMMERCE COMMITTEE Mayor James E. Elson P. 0. Box 580 Kenai, Alaska 99611 Dear Mayor Elson: Enclosed is SENATE BILL 248, which pertains to an Act re- lating to preleasing of mobile home lots. I would appreciate your comments and/or position papers on this Bill, to include a fiscal note, if appropriate. If you decide that a fiscal note is not required, please make such a statement in your reply. If your Department recommends specific changes, in addition to general comments, I would prefer that they be keyed to page and line numbers. If you know of other departments or agencies that have an interest in this legislation, please let me know so that I may get the benefits of comments from all knowledgeable and interested parties. I further request that your comments/position paper be re- turned to the Senate Commerce Committee as soon as possible. Your expeditious response to this request will be very much appreciated. WEB/k Encl Sincerely, W. E. (BRAD) BRADLEY State Senator Chairman, Senate Commerce Committee . LAC � � .._ d _l.! �- - I V. 8 4 Introduced: 3/14/77 Referred: Commerce and Judiciary I IN THE SENATE BY FERGUSON BY REQUEST 2 SENATE BILL N0. 248 . 3 IN THE LEGISLATURE OF THE STATE OF ALASKA 4 TENTH LEGISLATURE - FIRST SESSION S A BILL s For an Act entitled: "An Act relating to preleasing of mobile home lots." 7 BE IT ENACTED BY THE LEGISLATURE OF THE STATE OF ALASKA: s * Section 1. AS 45.30 is amended by adding a new section to read: s Sec. 45.30.080. PRELEASING. (a) No mobile home park owner or 10 operator may prelease any group of lots in his mobile home park if the 11 park is located in a municipality determined by the attorney general to 12 be critically low in the number of mobile home lots available. The 13 attorney general may call upon any state agency or municipal government 14 to aid him in determining which municipalities are critically low in is mobile home lots under the standards established by (b) of this section. is (b) A municipality is critically low in mobile home lots when 17 (1) there is a significantly higher demand for the lots than 18 there are lots available; and 19 (2) this situation is such that it will likely remain static, 20 become worse, or make no substantial improvement in the foreseeable 21 yi future. 22 (c) For the purposes of this section, - 23 (1) "lot" means the space providod in a mobile home park for - 24 one mobile home; 25 (2) "prelease" means leasing more than one lot in a mobile 28 home park to a manufacturer or dealer in mobile homes. 27 28 J SB 248 s r k. L EGILATIVE'ACTION "YOUR MUNICIPALITY HAS A BRANCH OFFICE IN THE CAPITAL" LEGISLATIVE BULLETIN ff 8 11ARCH 14,1977 INDEX (Refere to previous bulletins for bills not listed in this Index) !iulletin P.-ferences General Comments 1 Legislative Committees 1 Legislative Telephones 2 HOUSE BILLS 11H 70 Revenue Sharing 2-8 11B 72 Historical Districts 2-4,8 C11SB 84 Voting Polls 2-8 H8 89 School Construction Aid 2-6,8 11B 106 Gross Business License Tax 3-8 11B 110 Planning and Zoning 3-8 HB 131 Freedom of Information 6-8 HB 147 Public Projects 4-6,8 11B 153 Conventions and Travel 4-8 11B 214 Judicial Service Costs 6-8 11B 218 Voter Registration 6-8 HB 219 Shore Facilities Construction 6-8 11B 232 Liquor Sales Tax 6-8 TIB 240 Alcoholic Beverages 7-8 HB 243 Public Meeting 7-8 118 254 Public Information 7-8 HB 256 Raw rich Tax 7-8 HB 273 Third Class Boroughs 7-8 HB 305 Alcoholic Deverago Sales 11B 313 Municipal I-lanagers HS 324 Property Tax Exemptions 8 7-8 =17 I I I VA L "g.'a JW1 E GISLATIVE ACTION "YOUR MUNICIPALITY HAS A BRANCH OFFICE IN THE CAPITAL" LEGISLATIVE BULLETIN # 8 INDEX CONTINUED .SENATE BILLS SB 50 Utilities and Right of ways 6-8 SB 89 Court Proceedings Bonds 3-8 CSSB 114 Public I -lurks 4-6,8 CB 126 Runoff Elections 4-6,8 SB 127 Tax Foreclosed Property 4-6,8 SB 163 School Construction Facilities 6-8 SB 172 Foreclosure Notices 7-8 SB 179 Judicial Service Costs 7-8 SB 182 11unicipal Sales Taxes 7-8 SB 183 Alcoholic Beverages 7-8 SB 201 School Construction Funding 8 SB 208 14unicipal Organization Grants 8 SB 210 Property Tax Repeal 8 SB 220 Coastal Zone Hanagment 8 SB 223 Borough Charters 8 SB 227 Enviormental Coordination Procedures 8 SB 234 Religious Recreational Property 8 1 I HOUSE BILLS HB 70 Revenue Sharing - Has recieved no further action in the Finance Committee HB 72 Historical Districts - Has recieved no further action in the Finance Committee. CSHB 84 Voting Polls - A substitute bill passed the House, 26-12, 3/8/77 and has been refered to the Senate State Affairs a Finance Committees. 11B 89 School Construction Aid - A substitute bill has recieved a "do pass" rsconmendation from the IT.SS Cor,=ittee and has been refered to the Finance Committee. HO 106 Gross nu3iness License Tax - I'as recieved no further action in the Finance Committee. IM 110 Planning & Zoning - This bill has been refered to the Senate CRA Committee. ND 131 Freedom of Information - h substitute bill has recieved a "do pass" recommendation from the State Affairs Committee and has been refered to the Judiciary Committee. B 147 Public Projects - A substitute bill has recieved a "do pass" recommendation from the CRA Committee and has been refered to the Rules Committee. RB 153 Conventions & Travel - Has revieved no further action in the Finance Committee. H13 214 Judicial Service Costs - Has recieved no further action in the Finance Com.ittee. HS 218 Voter Registration - Tlas recieved no further action in the State Affairs Committee. IM 219 Shore Facilities Construction - ras recieved no further action in the CRA Committee. 11B 232 Liquor Sales Taxes - has recieved no further action in the CRA Committee. -1- 11 V HB 240 Alcoholic nevp-rages - 11as recieved no further action in the Judiciary Committee. 3 243 Public Meetings - 11as recieved no further action in the State Affairs Committee. TIB 254 Public Information - Has recieved no further action in the State Affairs Committee. Hb 256 Ravi Fish Tax - Has recieved no further action in the CRA Committee. 3B 273 Third Class Boroughs - Pas recieved no further action in the CRA Committee. HB 305 Alcoholic Beverage Sales - Introduced by Malone, this bill prohibits the sale of intoxicating liquors between the hours of 2:00 p.m. and 5:00 p.m. and between the hours of 11:00 p.m. and 10:00 a.m. of the following day, each day of the week; and 10:00 a.m. and 5:00 p.m. on Sundays. The bill also provides that a municipality may provide for adOitional closing hours. The bill has been refered to the Commerce and State Affairs Committee. HB 313 Municipal managers - Introduced by Rudd, this bill provides that a borough Mayor may not veto an ordinance or resolution calling for an election on the question of establishing a manager form of government. The bill has been refered the CRA and Judiciary Committees. ► 11B 324 Property Tax Exemption - Introduced by McKinnon, Bradley, and Meekins, this bill exempts the permanent place of abode owned by a disabled veteran from real property taxes. The exemption falls under the section providing for reimbursment of lost revenues. The bill has been refered to the State Affairs and Finance Committees. SENATE BILLS SS 50 Utilities and Right of Ways - Has recieved no further action in the Commerce Committee. SB 89 Court Proceedings Bonds - Has recieved no further action in the House Judiciary Committee. SB 114 Public Works - A substitute bill passed the Senate, 18-0, 2/8/77, and has been refered to the House State Affairs Committee. I M i r SB 126 Runoff Elections - This bill passed the Senate, le -1, 3/8/77, and has been refered to the house CRA and '--li.aiary Corurittees . SB 127 Tax Foreclosed Property - This bill has recieved a "do pass" recommendation from the Judiciary Committee and !� has been refered to the M% Committee. I 3H 163 School Construction Facilities - Has recieved no further action in the HESS Committee. SB 172 Foreclosure notices - Has recieved no further action in the Judiciary Committee. SB 179 Judicial Service Costs - Has recieved no further action in the CRA Committee. SB 162 I;unicipal Sale3 Taxes - IIas recieved no further action in the Special Committee on Alcoholism. SS 183 Alcoholic Beverages - Has recieved no further action in the Special Committee on Alcoholism. SB 201 School Construction Funding - Introduced by Ferguson, this bill establishes the following formula for state aid in school construction: During each fiscal year, the state shall allocate to an organized borough or a city which is a school district the following sums; (1) Payments ;made by the city or borough during the fiscal year two years earlier for the retire- nent of principal and interest on outstanding bonds, notes, )r other indebtedness incurred before July 1,1978 to pay costs school construction. (2) cash payments made by the borough )r city during the fiscal year two yeare earlier to pay costs of school construction incurred before July 1,1978. An organized borough or city which is a school district may apply annually to the commissioner for partial or complete state funding of particular school construction projects. The bill has been refered to the HESS and Finance Committees. SB 208 :Iunicipal Organization Grants - Introduced by the Rules Committee at the request of the Governor, this bill establishes the following organization grants for newly incorporated cities and boroughs: Each newly incorporated borough, except a unified municipality incorporated under AS 29.68.290 - 29.68. 990, is entitled to $100,000 for each of the first two years and $50,000 for the third year following incorporations in addition, if the newly incorporated borough -3- I daeeeLEM I M­-MAIL,�-11-i Jlal.IJ!I,�!IJL.1..:WL,L.L w has and exercises the powers of police protection, fire protection, or health services, on an areawide basis, it is -n%'if.?ed to $25,000 for prwar exercised for each of the three p years following incorporation in which that power is exercised. F Each newly incorporated city, except a unified municipality incorporated under the provisions of AS 29.68.290 - 29.68.440, is entitled to $25,000 each year for the first three years following incorporations however, each first class city established by reclassification outside an organized borough is only entitled to a one-time grant of $25,000. The bill has been refered to the CRA and Finance Committees. SB 210 Property Tax Repeal - Introduced by Ferguson and Huber, this bill not only repeals the authority of municipalities to collect property taxes but rewrites complete sections on special assessments, foreclosure procedures, and repeals many sections of Title 29. This bill does provide that the state shall reimburse a municipality for the property tax revenues lost to it by the operation of secs. 1-14 of this act. Reim- bursement will be made annually in an amount equal to the total of real and personal property taxes due and payable to the municipality for the last complete fiscal year of the municipality ending on or before December 31,1978. This bill has an effective date of January 1,1979. The bill has been refered to the Resources and Finance Committees. SB 220 Coastal Zone Managment - Introduced by the Rules Committee at the request of the Joint Administration -Legislative CoJrmittee on Coastal Managment, this bill establishes the Alaska Coastal Policy Council, Coastal Area Boards, Coastal Resource Service Areas, etc. The bill provides detailed procedures for the managmeny of Coastal resources. The bill has been refered to the Recources and Finance Committees. SB 223 Borough Charters - Introduced by the Rules Committee at the request of the Governor, this bill provides that a petition for incorporation of a first class borough may request that the question of election of a charter commission be placed upom the same ballot. The bill also provides that if the questions of incorporation and the election of a charter commission are approved, the borough assembly within 30 days after : certification of the election results shall order a special election to elect a charter commission. The election shall be held not less than 30 nor more than 90 days after the date of the election order. The election order must specify the dates during which nomination petitions for election of charter commission members may be filed. The seven candidates recieving the highest number of votes shall immediately organize as a charter commission. This bill has been refered to the CRA Committee. -4- I- I /' - V I - - - - - -- - -- V- - -t- - "- -- , _ - --MINW- � SB 227 Enviormental Coordination Procedures - Introduced by Poland and Tillion, this bill attempts to simplify the procedures necessary to obtain permito to undertake projects which utilize the states air, land, and water resources. The bill provides for compliance with local planning and zoning ordiniances. The bill h.,s been retered to the Resources Committee. SB 234 Religious Recreation Property-- Introduced by Sumiter, this bill exempts from local taxes theNreal property owned by a religious organization and used for a youth encampment or similar recreational purposes. The exemption also applies to rental payments on all leased land. The bill has been refered to the Resources and finance Committees. -5- in lu I V --_—�-V-- -.- ,� • T- .� _ 1 --�-fir ra P"V.Ri loll I. 1!IIISl!1_ 11,1.111 .I U Alaska *tdc `Xesiolatmt OENATOR JOE ORSINI o 2912 ALDER DRIVE COMMITTEES ANCHORAGE, ALASKA 99804 d �4 REsouRCes WHILE IN JUNEAU , eoMMERee POUCH V JUNEAU, ALASKA COMMUNITY O REGIONAL ^"AIRS 99611 March 28, 1977 Mayor James Elson City of Kenai P.O. Box 580 Kenai, Alaska 99611 Honorable James Elson: One of the less recognized aspects of the Alaska Native Land Claims Settlement Act (ANCSA) has been those provisions of Section 14(c)(3) and (4), relating to the reconveyance of Village land to governmental agencies (see enclosed copy of the Section and the pertinent Alaska Statute, AS 44.47.150). However, as the land conveyance process approaches comple- tion, this reconveyance portion of the ANCSA will undoubtedly become more of an issue. Because of the numerous questions that will inevitably be raised regarding the implementation of these sections, it is the feeling of the Senate Community and Regional Affairs Committee that we should begin to address the issue now, before the occurrence of possible confrontation, so as to see if some mutually acceptable procedures can be reached. It would seem to be in the best interests of all concerned that some sort of planning process be undertaken regarding the selection of the land to be reconveyed, which could involve the use of state funds. It will help our consideration of the subject if we could get some information with respect to your current disposi- tion on the issue. In that regard, we would appreciate your response to the questions on the following page. Please reel free to elaborate on any of your answers, and make whatever other comments you desire. JO/js Enclosures: As stated Sincerely, . ©/►A� e Orsini, Chairman Senate Community and Regional Affairs Committee 1. 4 F_ - - - __ - __ / I- ..w _ _ M , a Pub. Law 92-203 16 _ December 18, 1971 eS SPAT. 703 finds is qualified for land benefits under this Act, the Secretary, shall issue to the Village Corporation a patent to the surface estate in the number of acresshown in the following table: It the Tillage ha4 ou the 1970 census It shall be entitled to a patent to an enumeration data a Native popnia- area of public lands equal to— lion between - 23 and 89 ............................ 09.120 acres. 100 sad log-------------------------- 92.109 acres. 200 and 899 .......................... 135= acres. 400 and ti99----»----------------_- 188290 acres. 600 or more. ....................... 101.280 acres. The lands patented shall be those selected by the Village Corpora. tion pursuant to subsection 12(a). In addition, tits Secretary- shall issue to the Village Corporation a patent to the surface estate In the lands selected pursuant to subsection 12(b). �b) Immedtateiy after selection byy any Village Corporation for a Aatire village listed in section 16 -.21ch the Secretary finds is quali- fied for land benefits under this Act, the Secretary shall issue to the Village Corporation a patent to the surface estate to 28,848 acres. The lands patented shall be the lands within the township or townships that enclose the Native village, and any additional lands selected by the Pillage Corporation from the surrounding townships withdrawn for the Native village by subtection 10(a). Patent (c) Each patent iFstted pursuant to subsections (a) and (b) shall requirements. be 9 to the requirements of this subsection. Upon receipt of a patentor ppaatents A) the Vilinge Corperation shall first convey to any Native or non -Native oecapant, without consideration, title to the surface estate in the trnet-ereupied as a primary place of residence, or as a primary place of business, or as a subsistence campsites or as headquarters for reindeer husbandry; 12) the Village Corporation shall then convey to the occupant, either without consideration or upon ppayment of an amount not in e3:cess of fair market vallis, determined as of the date of initial occupancy and without regard to any improvetarnts thereon, title to His surface estate in any tract occupied by a. nonprofit organiaation: j A) the Village Corporation shall then convey to any Munici• pa Corporation in Lha Native village or to the Atate in trust for kl Xunici al Cki oration establ5hed in the Native villa in the future, title toThe remaining surface estate of the improved land on which the Native village is located and as much additional land as is necessary for community expansion, and appropriate rights -o# -way for public use, and outer fornrecable community needs: Fronded, That the amount of lands to be transferred to tate 3fnnicipal Corporation or in trust shall be no teas than 1,280 t arm; i , (4) the Village Corporation shall convey to the Federal Gov- ernment, State or to the appropriate Municipal Corporation, title to tate sutrfaee estate for existing airport sites, airway beacons, and other navigation aids, together with such additional acreage nnd/ or easements as are necessary to provide related services and to insure We npproachesto airport tuntvaya: and (5) for a periost often years after ttte date of ennetment of this Act, the Regional Corporation shall be afforded the opportuuity to review and render advice to the Villar. Corporations on all land sales, leases or other transactions prior to any final commitment. i LM Has your municipality been aware of the provisions of Section 14(c)(3) and (4) of the ANCSA? Have you given consideration to taking some formal action in that regard? Have you conferred with the Village on this issue? Has any agreement been reached between you and the Village on how to proceed in this regard? Have you reached any agreement with the Village on the lands to be conveyed under Section 14(c)(3) and (4)? Does it appear as though there may be a confrontation on the issue? What do you feel the State Legislature or Administration can do to help in this land selection and conveyance? Prepared By: Title: Municipality Of: § 44.47.150 STATE GOVERKMENT § 44.47.170 1 Sec. 44.47.150. Village land conveyed in trust. (a) The commissioner ' of the Department of Community and Regional Affairs is designated to �a accept, administer, and dispose of land conveyed to the state in trust by village corporations under § 14(c)(3) of the Alaska Native Claims Settlement Act (P.L. 92.203, 85 Stat. 703) for the purposes specified in that section. (b) Transfer of land by sale, lease, right-of-way, easement, or permit, Including transfer of surface resources, may be made by the commissioner only after approval of an appropriate village entity such as the traditional council, a village meeting, or a village referendum. Such approval shall be by resolution filed with the department. (c) Within one complete state fiscal year after the incorporation of a municipality in the village or of a municipality which includes all or part of the village, land acquired under this section shall be conveyed without cost to the municipality, and the municipality shall succeed to all the entrusted interest in the land. (d) Separate accounts shall be maintained in the name of each village for the land, including the revenues from the land, acquired from each village corporation under this section, and within 90 days of the close of each state fiscal year a statement of the account for each municipality shall be prepared by the commissioner and be made available to the village and to the public upon request. (e) Upon the conveyance of land to a municipality under this section, the commissioner shall account to the municipality for all profits Including interest from the land, and the municipality may then request that the governor submit a request to the legislature for an appropriation for the amount due it. (f) No title or interebt to lands aNuired by the department under this section may be acquired by adverse possession or prescription. (g) For the purposes of this chapter, the term municipality includes only first and second class cities incorporated under the laws of the state. (§ 1 ch 119 SLA 1975) i EOI LA .IVE ACTION ,YOUR MUNICIPALITY HAS A BRANCH OFFICE IN THE CAPITA!" LEGISLATIVE BULLETIN ff 8 !!ARCH 14,1977 IVDEX (Refere to previous bulletins for bills not listed in this Index) Bulletin P�-ferences General Comments 1 Legislative Committees 1 Legislative Telephones 2 HOUSE BILLS IIB 70 Revenue Sharing 2-8 Iib 72 historical Districts 2-4,3 CIISB 84 Voting Polls 2-8 HS 89 School Construction Aid 2-6,8 HS 106 Gross Business License Tax 3-8 HB 110 Planning and Zoning 3-8 HD 131 Freedom of Information 6-8 HB 1.47 Public Projects 4-6,8 IIB 153 Conventions and Travel 4-8 IIB 214 Judicial Service Costs 6-8 HE 218 Voter Registration 6-8 HB 219 Shore Facilities Construction 6-8 HB 232 Liquor Sales Tax 6-8 HB 240 Alcoholic Beverages 7-8 HB 243 Public Meeting 7-8 HS 254 Public Information 7-8 HE 256 Raw Fish Tax 7-8 HB 273 Third Class Boroughs 7-8 HE 305 Alcoholic Beverage Sales 8 11B 313 Municipal Managers 8 HE 324 Property Tax Exemptions 8 7-8 ,I- r M r LEGISLATIVE ACTION "YOUR MUNICIPALITY HAS A BRANCH OFFICE IN THE CAPITAL" LEGISLATIVE BULLETIN # 8 TNPr•.x CONTTN IEV .3ENATE BILLS SB 50 Utilifi�r, and Right of ways 6-8 SB 89 Court Ptuuc,,ainejp minas 3-8 CSSB 114 Public Works 4-618 CB 126 Runoff Flections 4-6,8 SB 127 Tax Foreclosed Property 4-6,8 SB 163 School Construction Facilities 6-8 SB 172 Foreclosure Notices 7-8 SB 179 Judicial Service Costs 7-8 SB 182 Municipal Sales Taxes 7-8 SB 183 Alcoholic Beverages 7-8 SB 201 School Construction Funding 8 SB 208 Municipal Organization Grants 8 SR 210 Property Tax Repeal 8 SB 220 Coastal Zone Pianagment 8 SB 223 Borough Charters 8 SB 227 Enviormental Coordination Procedures 8 SB 234 Religious Recreational Property 8 1 eti i. a 1 a 1 HOUSE BILLS HB 70 Revenue Sharing - Has recieved no further action in the Finance Committee Iib 72 Historical Districts - Has recieved no further action in the Finance Committee. CSHB 84 Voting Polls - A sub3titute bill passed the House, 26-12, 3/8/77 and has been refered to the Senate state Affairs & Finance Committees. 1IB 89 School Construction Aid - A substitute bill has recieved a "do pass" re-coirimendation from the IMSS Cotianittes and has been refered to the Finance Committee. HE 106 Gross nU31ness License Tax - Pas recieved no further action in the Finance Committee. HS 110 Planning a Zoning - This bill has been refered, to the Senate CRA Committee. HE, 131 Freedom of information - A substitute bill has recieved a "do pass" recommendation from the State Affairs Committee and has been refered to the Judiciary Committee. B 147 Public Projects - A substitute bill has recieved a "do pass" recommendation from the CRA Committee and has been refered to the Rules Committee. HB 153 Conventions & Travel - 11as revieved no further action in the Finance Committee. HE 214 Judicial Service Costs - Has recieved no further action in the Finance Committee. HE 218 Voter Registration - 11as recieved no further action in the State Affairs Committee. HB 219 Shore Facilities Construction - Has recieved no further action in the CRA Committee. I 3 HE 232 Liquor Sales ".faxes - has recieved no'further action -i in the CRA Committee. i7 M 11 i M 240 Alcoholic Beverages - fias recieved no further action in the Judiciary Committee. i B 243 Public "?eptings - Has recieved no further action in the State Affairs Committee. IIB 254 Public Information - Has recieved no further action in the State Affairs Committee. Hb 256 Ravi Fish Tax - Has recieved no further action in the CRA Committee. Iib 273 Third Class Boroughs - itas recieved no further action in the CRA Committee. HB 305 Alcoholic Beverage Sales - Introduced by Malone, this bill prohibits the sale of intoxicating liquors between the hours of 2:00 p.m. and 5:00 p.m. and between the hours of 11:00 p.m. and 10:00 a.m. of the following day, each day of the week= and 10:00 a.m. and 5:00 p.m. on Sundays. The bill also provides that a municipality may Provide for additional closing hours. The bill has been refered to the Commerce and State Affairs Committee. 11B 313 Municipal Managers - Introduced by Rudd, this bill provides that a borough Mayor may not veto an ordinance or resolution calling for an election on the question of establishing a manager form of government. The bill has been refered the CRA and Judiciary Committees. iiB 324 Property Tax Exemption - Introduced by McKinnon, Bradley, and P4eekins, this bill exempts the Permanent place of abode owned by a disabled veteran from real property taxes. The exemption falls under the section providing for reimbursment of lost revenues. The bill has been refered to the State Affairs and Finance Committees. SENATE BILLS Sia 50 Utilities and Right of gays - Has recieved no further action in the Commerce Committee. SB 89 Court Proceedings Bonds - tias recieved no further action in the House Judiciary Committee. Sn 114 Public Works - A substitute bill passed the Senate, 18-0, 2/8/77, and has been refered to the f:ouse State Affairs Committee. -2- SS 126 Runoff Elections - This bill passed the Senate, 18-1, 3/8/77, and has been revered to the House CRA and Judiciary Cor=ittees. SB 127 Tax Foreclosed Property - This bill has recieved a "do pass" recommendation from the Judiciary Conmittee and has been refered to the CRA Committee. SB 163 School Construction Facilities - Has recieved no further action in the HESS Committee. SB 172 Foreclosure Notices - Has recieved no further action in the Judiciary Committee. SS 179 Judicial Service Costs - Has recieved no further action in the CRA Committee. SB 182 I;unicipal Sales Taxes - Has recieved no further action in the Special Conmtittee on Alcoholism. SB 183 Alcoholic Beverages - Has recieved no further action in the Special Committee on Alcoholism. SB 201 School Construction Funding - Introduced by Ferguson, this bill establishes the following formula for state aid in school construction: During each fiscal year, the state shall allocate to an organized borough or a city which is a school . Ustrict the following sums: (1) Payments made by the city :,r borough during the fiscal year two years earlier for the retire- ment of principal and interest on outstanding bonds, notes, or other indebtedness incurred before July 1,1978 to pay costs f school construction. (2) cash payments made by the borough or city during the fiscal year two years earlier to pay costs of school construction incurred before July 1,1978. An organized borough or city which is a school district may apply annually to the commissioner for partial or complete state funding of particular school construction projects. The bill has been refered to the HESS and Finance Committees. SB 208 11unicipal Organization Grants - Introduced by the Rules Committee at the request of the Governor, this bill establishes the following organization grants for newly incorporated cities and boroughs: Each newly incorporated 15orough, except a unified municipality incorporated under AS 29.68.240 - 29.68. 440, is entitled to $100,000 for each of the first two years and $50,000 for the third year following incorporations in addition, if the newly incorporated borough -3- 0 has and exercises the powers of police protection, fire protection, or health services, on an arp.ai;iut» basis, it is F-ntitled to $25,000 for pcwar Prercised for each of the three ye;ars following incorporation in which that powcr is exercised. Each newly incorporated city, except a unified msanicipality incorporated under the provisions of AS 29.68.240 - 29.68.440, is entitled to $25,000 each year for the first three years following incorporations however, each first class city established by reclas;sifacation outside an organized borough is only entitled to a one-time grant of $25,000. The bill has been refered to the CRA and Finance Committees. 3B 210 Property Tax Repeal - Introduced by Ferguson and Huber, this bill not only repeals the authority of municipalities to collect property taxes but rewrites complete sections on special assessments, foreclosure procedures, and repeals many sections of Title 29. This hill doers provide Ithat the state shall reimburse a municipality for the property tax revenues lost to it by the operation of secs. 1-14 of this act. Reim- bursement will be made anneally in an amount equal to the total of real and personal property tuxes due and payable to the municipality for the last complete fiscal year of th^ municipzli;:y ending on or before December 31,1978. This bill has an effective date of January 1,1979. The bill has been refered to the Resources and Finance Conmiittees. 3B 220 Coastal Zone Managment - Introduced by the Rules Comnattee at the request of the Joint Adnsini.stration-Legislative Committee on Coastal Managment, this bill establishes the Alaska Coastal Policy Council, Coastal Area Boards, Ccastal Re3ou:.ce Service Areas, etc. The bill provides detailed procedures for the manacment of Coastal resources. The bill has been refered to the Recources and Finance Committees. SB 223 Borough Charters - Introduced by the Rules Comnsittee at the request of the Governor, this bill provides that a petition for incorporation of a first class borough may request that the question of election of a charter commission be placed upom the same ballot. The bill also provides that if the questions of incorporation and the election of a charter commission are approved, the borough assembly within 30 days after certification of the election results shall order a special election to elect a charter commission. The election shall be held not less than 30 nor more than 90 days after the date of the election order. The election order must specify the dates during which nomination petitions for election of charter commission members may be filed. The seven candidates recieving the highest number of votes shall immediately organize as a charter commission. This bill has been refered to the CRA Committee. -4- - - -n SB 227 Enviormental Coordination Procedures - Introduced by Poland and Tillion, this bill attempts to simplify the procedures necessary to obtain permits to undertake projects which utilize the states air, land, and water resources. The bill provides for compliance with local planning and zoning ordiniances. The bill 11:-,-S been refered to the Resources Committee, SB 234 Religious Recreation Property - Introduced by Sumner, this bill exempts from local taxes the real property owned by a religious organization and used for a youth encampment or similar recreational purposes. The exemption also applies to rental payments on all leased land. The bill has been refered to the Resources and Finance Committees. -5- A 11 EGISLATIVE ACTION "YOUR MUNICIPALITY HAS A BRANCH OFFICE IN THE CAPITAL" LZG*ISLX7IVL J3UfT,ET11 !110 "ARCK, 23,1977 I!TDEX (Refer to previous bulletins for bills not listed in this index.) General Coram ents I Legislative Conmitter.s 1. Legislative Telephones 2 HOUSE BILLS HB 52 0i3,F!rutinq T3udget 1-2,10 H3 72 Historical Districts 2-4,8-10 CS11B 84 Voting Polls 2-10 11B 89 School Construction Aid 2-5,8-10 11B 110 Planning and Toning 3-10 11B 131 rreedon; of Information 6-10 HD 134 Ordinance Violation 3-7,9-10 119 147 Public 1-1rojects 4-6,8-10 HB 190 Air Pollution Control 5-7,9-10 11B 209 131--ilities and Ricjht of Hays 5-7,9-10 f1B 234 Pablic Ynformation 7-10 un 256 Raw Fish Tax 7-10 Hr, 305 Alcoholic Beverage Sales 8-10 11R 313 I-lunicival 14anagars 8-10 110 324 Property Tax Exemption 8-10 IIB 342 Coastal Zone "anagement, 9-10 HS 348 Farm Use Lands 9-10 lin 354 Public r-iltity Liability 9-10 HB 372 Tjn�riployment Insurance. 9-1.1 HB 376 Property 'pax rplief 10 F3 377 Property Tax Penalties 10 A I SEDATE, BILLS 3B 47 P-gar,(-rty '_"ax P.xemption 2-4,9-10 SB 50 Utilities and right of Ways 6-10 SB 89 Court proceedings Ponds 3-10 SB 114 Public t•Iorks A-6,8-10 SB 126 Runoff elections 4-6,9-10 SB 127 Tax-FornclosQd Property SB 172 roreclosure notices 7-10 SB 179 Judicial S4rvice Costs 7-10 SB 182 Municipal Gales Taxes 7-10 SB 183 Alcoholic Beverages 7-10 SB 201 School I.onstruction runding 8-10 Sr, 209 Tiunici»al Organization Grants 8-10 SB 210 Property Tax Repeal 8-10 SB 220 Coastal ?one 8-10 SB 223 Borough Charters 8-10 S13 227 Enviormantal Coordination Procedures 8-10 SB 231 Religious Recreation Property 8-10 SB 241 Hunicipal Land Selection 9-10 SB 2419 Ptiblic Entity Liability 9-10 SB 259 Municipal Utilities 9-10 Sr 283 Social Security Accounts 10 I IL L PA HOUSE BILLS HB 52 013 -rating Budg�t ; `.rhe Itouse passed its substit,ite version of the b dggt, 28-10, 3/25/77 and th" bill will by sent to the S-nat- Finance Committe-. llnd­ir normal i circumstances, this Mould b?gin to trigger the -nd of the session, but don't look for it to happen this year. Shared revenue was incrryased by the. Iious- from ~17,6,17,700 to $19,600,200. • Kb 72 Historical Districts; Iias reci-vec' no further action in the Finance Committee. CSHB 84 doting Polls; Has reci-ved no further action in the Senate State Affairs Committee. EIS 89 School Construction kid; Iias rPcievPd no further action in the finance Committee. HB 110 Planning and Zoning;"This bill has recieved a "do pass" k recommendation from the Senate CRA Committee and has beon refered to the !,ales Committee. HB 131 Freedom of Information; Has recieved no further action in the Judiciary Committee. IiE 134 Ordinance Violation; Iias recievsd no further action in the Senate CRA Committee. HB 147 Public Projects; This bill passed the House 34-0, 3/23/77, and has been refered to the senate CRA and State Affairs Committees. HB 190 Air Pollution Control; This bill passed the Itousq 34-0,3/23/77, and has'been refered to the Senate MA Committee. HB 209 Utilities and Right of I -lays; Has reciev-d no further action in the Rules Committee. IIB 254 Public Information; This bill passed the house 36-0, 3/21/77, and has been refered to the S -nate State Affairs and Judiciary Committees. HA 256 Raw Fish Tax; Has recieved no further action in the Finance Committees. HB 305 Alcoholic Beverage Sales; Has recieved no further action in the Commerce Committee. IIB 313 Municipal ftanagnrs; Has recieved no further action in the CRA Committee. (1) -" I t FA IIB 32.1 Prop-rty Tax Fxf!mpticn; Has r, ci,!v�cl no furth.!r action in the State Affairs (,ummitt,rs. s; 1IB 3,12 Coastal Zuni ''_ana(lement; Has reci•ived no Furth -?r '' action in the CRA Committee. r' y. HB 348 Faxm Us -Ft bands; Has recieved no further ac -tion in the Resources ConmtittA4. JIB 354 Public l;ntity Liability; IIas r -sieved no further action in the Judiciary Committee. IIB 372 Unemployment Insuranc o; ITas rNcieved no further action in the Labor and "anagrimQnt Committee. HB 376 Property Tax n -lief; Introduced by McY.innon and seven other Representatives, this bill provides that a resident who,on T) -comber 31,oceupiris a hom4ste.ad which h-, owns is entitled to a homestead refund equal to the property taxes levied against the homestead in that calend-r year or the maximum refundable owner property tax stated in the table in (g) of this section for his household incom-, whichever is less. P resident who rents and occupies a homestead or a succession of homesteads at any time during a calender year and who does not, on December 31, occupy a homestead which lie owns is entitled to a homestead refund Qoual to the rent constituting property tax paid for the homestead or homesteads during that part of th- calender year in which he was in occupancy or the maximum refundable rent constituting property tax statad in the table in (g) of this section for his household income, whichever is less. The bill has bpen refered to the CRA and finance Committee. IIB 377 Property Tax Penalities; Introduces] by '40;innon, this bill provides that no penalty may be added to a delinquent real or personal property tax if this assessed value of the real or personal property of th- taxpayer reported in the annual assessment roll,-xclusive of property or improvmsnts to the property of the taxpayer first included in the annual assessment roll, exceeds by 301 or more the assessed value of the property reported in the annual assessment roll or supplemantal assessment roll for the previous assessment year. Thi bill -has been r.,fe.red to the CRA Committee. SENATE BILLS SB 47 Property Tax Exemption; Has recieved no further action in the House CRA Committee. SB 50 Utilities and Right of Plays; IIas recieved no further action in the Stat,2 Affairs Committee. SB 89 Court Proceedings Bonds, IIas reciev=gid no further action in th^ House Judiciary Committq-. (2) SB 114 Public Works; Fas r-cieved no furth<�r action in thr, State Affairs Committee. DD 126 Runoff Eltetions; Has reci9v,?d no furth-r action in the House CRA Committee. SB 127 Tax-For.iclosed Property; Has r=,cieved no further action in th-� Sz-tnate CRA Conmiittee. SD 172 Forclosurp. Votice; Has recieved no further action in the Judiciary Committee. SB 179 Judicial Service Costs; Has recieved no further action in the CRA Committee. SB 182 ftnicipal Sales Taxes; Has recieved no further action in the Special Committee on Alcoholism. SB 183 Alcoholic Beverageis; Has recieved no further action in th-A Special Committea on Alcoholism. SB 201 School Construction Funding; Has racievod no further action in the IIESS Committee. SB 208 Itunicipal Organization Grants; Has r,!cipvpd no further action in the CPA Committ--q. SB 210 Property Tax R-p-al; Lias recieved no further action in the Resources Committ-:te. SH 220 Coastal Vons 4anag,4ment; Has recieved no further action in the Resources Committee. SB 223 Borough Charters; Has recieved no furth-tr action in thQ CRA Committsq. SD 227 Enviormental Coordination Procvdurps; Has rucipV,-td no further action in tha *Resources Committee. SB234 Religious Recv�ation Property; Has recieved no further action in the Resources Committee. SB 241 11unicipal Land S,,lection; Has recieved no further action in the CRA Committee. SB 249 Public Entity Liability; An amended bill has rRcio.ved a "do pass" recomm*sndation from the CRA Committee and has been refered to the Judiciary Committee. The ampndm--!nt deleted stiction (4) dealing with assault, battiry, false imprisonment, etc. (3) EN D-r±--- SB 259 Municipal Utilities; !las reciF-v^d no furth?r action in the CRA Committpe. SB 283 Social Security Accounts; Introduced by flub -7,r, this bill provides that no state department, agency, board, commission, public corporation or oth-r subdivision of stat^ government may request or require that any pereon reveal his social security account number in ord9r to obtain services or, assistance, nor tray any state dr:partm-nt, ag?ncy, board, commission, public corporation or any other subdivision of state government use, for any purpos?, numbers which correspond to the social security number of any person. The bill has been refered to thA Judiciary Committee. r r -- T_ __ - __ . _ -, AI II;IL �._Ls....f! � - - - _ - _ -- .- s -- - -.. , ..;_.;br3s.o- — - •$1�17EY1g5*_._,.+, . .- . .. 0,,SEArrMF1.q_9r, RANH IRMESMIENTi NISI/®A AN -I F.0 Ho. 3586. Se,@a. 9304 O.H.V. 5.alue. Wals BUJ 552 0642 206 583 3551 OnQOn, Id.h. J ,. —l—, WAs 860 426 0210 March 15, 1977 Firstbank Public Finance Depart wtf specializes in service to state and local governmental units to all phases of municipal finance. Specifically, the service is geared to assist with any type of munici- pal borrowing (bonds, warrants, and others), investment of surplus funds or bond proceeds, and solutions to financial problems. MUNICIPAL BOND MARKET Prices dropped slightly during the first couple of weeks of this reporting period, and then stabilized throughout the remainder. Prices for the longer maturities have shown a slight increase, dropping the yields for those maturities slightly. The Bond Buyer index rose in the first week of the period to 5.92 from 5.83 and has remained unchanged since. Fon+ard supply in the mar- ket has also shown little change. Stability is expected to continue in the market in the short term. SALES FROM MID -FEBRUARY TO MID -MARCH BORROWING AND INVESTING Nervousness over the expectation that the Federal Reserve might move to a tighter monetary policy caused prices of government securities to decline further during the latter part of February. News of retail sales increase and the rise in the whole price index did not cause any significant changes in the market while participants continue to wait for expected effects of a faster growth in the money supply. ITEMS OF SPECIAL INTEREST Banks, one of the largest class of purchasers of municipal issues, r nder increasing pressure from national bank examiners to obtain ete credit information on the municipal issues that they hold. The ners, through a letter dated January 6, from the 6th District Admin - tor for national banks, outlined several types of data suggested for credit files of banks. The outline covers 17 points under the general headings of debt burden, tax base, quality of the issuers budget, and the character of the community. The points under the general headings are similar to the Municipal Finance Officers Association's Disclosure Guidelines for offer- ings of Securities by State and Local Governments. rm" 1114 4/14 AO 1284 _r NET SALE MATURITY INTEREST DATE RATING AMOUNT ISSUE PERIOD COST 2-16--7 0 210,000 Kitsap County SID No. 100-C 1979-87 4.75 Bremerton, Washington G.O. 2-22-77 Baa 1 9,000,000 Municipality of Anchorage, Alaska Rev. 1978-97 6.072 2-22-77 Baa 1 10,000,000 Municipality of Anchorage, Alaska Rev. 1978-97 5.9VI0 2-22-77 As 13,400,000 King County, Wash., L.T. 0.0.1979-92 4.86 2-23-77 1,300,000 City of Enumclaw, Wash. Rev. 1987-07 2-23-77 A 1 145,000,000 Washington Public Power Supply System Rev. 1989-15 5.933 3-01-77 72,000 Beaux Arts Village, Wa. G.O. 1979-89 5.25 3-03-77 A 870,000 Whitman County SID No. 301 Palouse, wash. 1976-96 5.28 3-14-77 A 1 2,750,000 City of Bellevue, Wash. L.T. G.O. 1979-97 5.41 3-14-77 250,000 City of Marysville, wash. G.0.1979-87 4.99 BORROWING AND INVESTING Nervousness over the expectation that the Federal Reserve might move to a tighter monetary policy caused prices of government securities to decline further during the latter part of February. News of retail sales increase and the rise in the whole price index did not cause any significant changes in the market while participants continue to wait for expected effects of a faster growth in the money supply. ITEMS OF SPECIAL INTEREST Banks, one of the largest class of purchasers of municipal issues, r nder increasing pressure from national bank examiners to obtain ete credit information on the municipal issues that they hold. The ners, through a letter dated January 6, from the 6th District Admin - tor for national banks, outlined several types of data suggested for credit files of banks. The outline covers 17 points under the general headings of debt burden, tax base, quality of the issuers budget, and the character of the community. The points under the general headings are similar to the Municipal Finance Officers Association's Disclosure Guidelines for offer- ings of Securities by State and Local Governments. rm" 1114 4/14 AO 1284 _r f As reported in the "American Banker" in a February 18, article, 'an official in the Comptroller's offices who was familiar with the letter...said that bankers must expect to request information from small issuers who are not accustomed to supplying current information to holders of their debt. Some information should be available for each of the general headings mentioned in the January 6, letter." Questions re- garding the disclosure items can be directed to the Public Finance Depart- ment at Seattle -First National Bank. RATES 90 Day 1 Year 7 Year Week Endinq T -Bill C.D. T -Note B.B.I. 3-04-76 5.18 6.00 7.73 7.04 3-11-76 5.00 6.00 7.68 6.96 3-18-76 5.00 6.00 7.61 6.92 3-25-76 4.90 5.875 7.52 6.72 4-01-76 4.95 6.00 7.60 6.69 4-08-76 4.90 6.00 7.42 6.65 4-15-76 4.75 6.00 7.30 6.54 4-22-76 4.70 6.00 7.33 6.55 4-29-76 4.60 6.00 7.42 6.55 5-06-76 4.85 6.00 7.51 6.71 5-13-76 5.05 6.50 7.68 6.83 5-20-76 5.35 6.125 7.79 6.91 5-27-76 5.60 6.25 7.86 7.03 6-03-76 5.55 6.25 7.77 6.89 6-10-76 5.40 6.25 7.70 6.86 6-17-76 5.40 6.25 7.70 6.85 6-24-76 5.32 6.25 7.60 6.87 7-01-76 5.35 6.25 7.70 6.87 7-00-76 5.36 6.25 7.67 6.78 7-15-76 5.11 6.00 7.55 6.78 7-22-76 5.21 6.00 7.67 6.77 7-29-76 5.15 6.00 7.60 6.73 8-05-76 5.16 6.00 7.S7 6.65 8-12-76 5.15 6.00 7.54 6.60 6-19-76 5.15 6.00 7.48 6.60 8-26-76 5.13 6.00 7.41 6.58 9-02-76 5.09 6.00 7.36 6.52 9-09-76 5.10 6.00 7.38 6.52 9-17-76 5.10 6.00 7.32 6.50 9-24-76 5.03 5.75 7.29 6.52 10-01-76 5.06 5.75 7.28 6.47 10-08-76 5.09 5.75 7.17 6.33 10-14-76 4.89 5.50 6.96 6.25 10-21-76 4.89 S.2S 6.92 6.30 30-28-76 4.88 5.25 7.00 6.33 11-04-76 4.60 5.25 7.07 6.34 11-11-76 4.91 5.25 7.02 6.39 11-18-76 4.80 5.25 6.89 6.26 11-25-76 4.64 5.10 6.61 6.16 12-02-76 4.36 5.10 6.32 6.03 12-09-76 4.43 5.00 6.32 5.96 12-16-76 4.31 4.875 6.34 5.95 12-23-76 4.28 4.875 6.33 5.93 12-31-76 4.36 4.675 6.37 5.83 1-07-77 4.47 4.875 6.49 5.78 1-14-77 4.58 5.00 6.92 5.89 1-21-77 4.63 5.00 6.90 5.90 1-28-77 4.73 5.125 7.14 5.92 2-04-77 4.73 5.25 7.19 5.92 2-11-77 4.63 5.25 7.12 5.86 2-17-77 4.61 5.25 7.08 5.83 2-24-77 4.72 5.25 7.2S 5.92 3-03-77 4.60 5.25 7.15 5.92 3-10-77 4.62 5.25 7.20 5.92 For financial consulting services or any other information re- lating to municipal finance, please contact the Public Finance Depart- ment as Seattle -First National Bank. Steve P. Gaidos 583-3472 Stephen P. Parke S83-3551 Dean J. Torkelson 583-3346 Jerry Braaten 583-3551 Myrna K. Corbett 583-3592 r 4 s� v - I IPPIAFUB AHG ,:.:. ". .. 1. Y' d 1-010184AO77003 03/18/77 I ICS IPMNAWA WSH •+��� 10080 NLGOVT NFWASHINGTON DC 94 03-18 1225P EST ' PMS JOHN E WISE CITY MANAGER BOX 580 KENAI AK 99611 THANK YOU FOR YOUR LETTER CONCERNING THE LACK -OF PLANNINR FUNDS AND RECREATION OR ENVIRONMENTAL GRANTS UNDER THE COASTAL ENERGY IMPACT PROGRAM (CEIP). A SENATE SUBCOMMITTEE HAS RESTORED FUNDING IN BOTH AREAS, THE FULL COMMITTEE ON APPROPRIATIONS WILL MEET NEXT WEE K T 0 VOTE ON T HE FY 1977 SUPPLEME NTAL APPROPRIATIONS. I WILL PRESENT A STATEMENT TO SUPPORT THE SUBCOMMITTEES ACT ION. PLEASE SUPPORT ME BY SENDING A TELEGRAM TO SENATOR MCCLELLAN, SENATE APPROPRIATIONS COMMITTEE, 1235 DIRY.SEN BUILDING WASHINGTON DC 20510 REQUESTING THE COMMITTEE TO ENDORSE THE SUBCOMMITTEES REINSTATEME19 OF THE PLANNING FUNDS AND RECREATION OR ENVIRONMENTAL GRANTS FOR THE CEIP, MIKE GRAVEL 1300 EST IPMAFUB ANG Phone Nol Phoned BY..p...T. Vi..........Dnyn/d1�S crc..Q Unruirsud.'fi16+dt"'"""""' '6Xi`Y'»• , s I f . ■ V__ - - __ ' 4 0 ---- - - - _-- -:..v--.�`rewi...+rr.,.e�..e�:rmY ::•---:••x.:..rwl.�: "`mCJI-_.L�. L UL 1I !61.01 1 WAi PENINSULA OVERALL ECONOMIC DEVELOPMENT PROGRAM JOINT KENAI-SOLDOTNA REGIONAL OEDP MEETING 7:30 p.m., Wednesday - February 23, 1977 -RESUME - JOINT Y?:NAI-SOLDOTNA REGIONAL OEDP MEETING Length of Meeting: 7:30 p.m. to 9:40 p.m. Meeting Location : Borough Building, Soldotna In attendance: Sillingslea, Earl - Soldotna Area Chairman Coyle, Waldo & Ruby - Kenai Day, George - Kenai Ford, George - Kenai Jackson, Glen - Kenai O'Reilly, Vince - Kenai Area Chairman Shadura, Alex - Kenai Brogan, Mick - OEDP Economist Mcllhargey, Frank - OEDP Director Purpose: The consideration of regional economic development poten- tials and problems overlapping the individual provinces of the two area OEDP groups. The basic economy of the Central Peninsula does not identify with community boundaries and therefore needs for fur- thering economic health should require the attention of all regional elements. Areas of Individual Committee Interest With Overlapping Significance: �,. OCS Planning and Impacts. 2. Water Supply and Distribution - Particular reference to the ques- tion of supplies needed for further industrial growth in the Nikiski area. 3. Sewage Collection and Treatment. 4. Industrial and Commercial Development. 5, Fire, Police and Emergency Medical Services.. 6. Transportation - Port facilities, airports and road improvements. 7. Conventions and Tourism. 9. Schools and School Facilities, 9. Residential Facilities. Earl Billingslea advised that his thoughts for suggesting this joint meeting was to determine if there was mutual interest for investigat- ing a regional approach to service needs such as might be provided 1 A, C■ Alex Shadura pointed out a need for an area wide study on the avail- ability of new water sources, such to include the Swanson River area where there is some promise of large quantities of subsurface water being available. . Considerations on the subject of Borough/State responsibility on water questions O'Reilly - Borough should play the key role. State does the tech-- uncal studias with the information provided to the Borough for local decisions. Ford - Borough could not afford the cost of the explorations or t'ec�nical staff needed. Borough position should be at the level of distribution of the water resource. Waldo Coyle - Suggested that State may need to be motivated to action on the Nikiski water question by industry threatening a close down of operations if water supplies are not available. Emerqency Medical Services - It was the general concensus of those I k - a % --------- -_under undera service district. He cited that fire services might be more efficiently provided throughout the area under a singular district than through the existing three department form. A joint fire district might open the door to other services being combined. A question was raised on whether a service district could provide multiple services. Waldo Coyle suggested that emergency medical services appeared as ' most needing a special district approach. Other services might be more readily combined thereafter. It was noted that service dis- tricting would require ecompassing the heavy industrial tax base = of the Nikiski and Upper Cook Inlet. Question was raised on the State's 20 mill tax levy on oil related activities, requesting specifics on which activities are subject to the tax and how much of that tax can be deducted for local tax purposes. This information is to be provided at a future meeting. Vince O'Reilly reviewed the topical subjects of joint committee consideration as listed on the agenda, noting that the question of future water supplies appeared as most significant areawide, a po- tential for limiting any future industrial development activity in the Nikiski area. He suggested the Kenai River might need to be looked at as the source for future industrial supplies. The indus- trial representatives in attendance advined that Kenai Rivcr water is not considered of good industrial quality due to the high per- centage of dissolved solids. A discuns;on of the Nikiski water question and the responsibility roles of St.ato and Borough governments in dealing with such prob- lema. Alex Shadura pointed out a need for an area wide study on the avail- ability of new water sources, such to include the Swanson River area where there is some promise of large quantities of subsurface water being available. . Considerations on the subject of Borough/State responsibility on water questions O'Reilly - Borough should play the key role. State does the tech-- uncal studias with the information provided to the Borough for local decisions. Ford - Borough could not afford the cost of the explorations or t'ec�nical staff needed. Borough position should be at the level of distribution of the water resource. Waldo Coyle - Suggested that State may need to be motivated to action on the Nikiski water question by industry threatening a close down of operations if water supplies are not available. Emerqency Medical Services - It was the general concensus of those I k - a —tet— -T —�--�- — 1-• � — r- - � -« � --T- •�--•. -F � �-�-�— 1 F -- - — -- ---------�---------• -- ' - "dlUl ill l{IIMIY�IfJI�!i VIII IlYli1111 ^^ I II I I I ,- II!I in attendance that the joint committee should recommend the forma- tion of a Central Peninsula Emergency Medical District. On Combining The Two Area Committees - Earl Billingslea suggested further consideration on the Kenai and Soldotna area committees combining to form a Central Peninsula Regional OEDP group. Submitted by: FRANK MCILHARGEY OEDP Director I 3/9/77 I 1 FMCIsrh